WBSCR28 cdna clone
WBSCR28 cDNA Clone
Synonyms
WBSCR28; WBSCR28 cDNA Clone; WBSCR28 cdna clone
Sequence
atggaggcccttcctccagtcagatccagccttttggggaacctgttgcaggttacgaggctctcagtgctgttggttcagaaccgagatcacctctataatttcctgctcctcaagatcaacctcttcaaccactgggtgtcagggctggcccaggaggcccgggggtcctgtaactggcaggcccacctacccctgggagctgcagactgccccctgggccaggctctccgggctgggctggctctgatacaggtccccgtatggctggtgctacagggacccaggctgatgtgggctggcatgtggggcagcaccaagggcctgggcctggccttgctcagtgcctgggagcagctgggcctgtctgtggccatctggacagatctgtttttgtcatgtctgcacggcctgatgttggtggccttgctcttggtggtagtgacctggagggtgtgtcagaagtcccactgcttccgactgggcaggcagctcagtaaggccttgcaagtgaactgcgtggtaaggaagctcctggtacagctgagacgtctgtattggtgggtggagactatgactgccctcacctcctggcacctggcctatctcatcacttggaccacctgcctggcctcccacctgctgcaggctgcctttgagcacacgacccagctggccgaggcccaggaggttgaaccccaggaggtctcagggtcttccttgctgccctcactgtctgcgtcctcggactcagagtctggaacagttttgccagagcaagaaactcccagagaataa
Sequence Length
798
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
6,195 Da
NCBI Official Full Name
Homo sapiens Williams-Beuren syndrome chromosome region 28, mRNA
NCBI Official Synonym Full Names
Williams-Beuren syndrome chromosome region 28
NCBI Official Symbol
WBSCR28
NCBI Protein Information
Williams-Beuren syndrome chromosomal region 28 protein
UniProt Protein Name
Williams-Beuren syndrome chromosomal region 28 protein
Protein Family
UniProt Gene Name
WBSCR28
UniProt Entry Name
WBS28_HUMAN
Uniprot Description
WBSCR28: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 7q11.23
Similar Products
Product Notes
The WBSCR28 wbscr28 (Catalog #AAA1269788) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggccc ttcctccagt cagatccagc cttttgggga acctgttgca ggttacgagg ctctcagtgc tgttggttca gaaccgagat cacctctata atttcctgct cctcaagatc aacctcttca accactgggt gtcagggctg gcccaggagg cccgggggtc ctgtaactgg caggcccacc tacccctggg agctgcagac tgccccctgg gccaggctct ccgggctggg ctggctctga tacaggtccc cgtatggctg gtgctacagg gacccaggct gatgtgggct ggcatgtggg gcagcaccaa gggcctgggc ctggccttgc tcagtgcctg ggagcagctg ggcctgtctg tggccatctg gacagatctg tttttgtcat gtctgcacgg cctgatgttg gtggccttgc tcttggtggt agtgacctgg agggtgtgtc agaagtccca ctgcttccga ctgggcaggc agctcagtaa ggccttgcaa gtgaactgcg tggtaaggaa gctcctggta cagctgagac gtctgtattg gtgggtggag actatgactg ccctcacctc ctggcacctg gcctatctca tcacttggac cacctgcctg gcctcccacc tgctgcaggc tgcctttgag cacacgaccc agctggccga ggcccaggag gttgaacccc aggaggtctc agggtcttcc ttgctgccct cactgtctgc gtcctcggac tcagagtctg gaacagtttt gccagagcaa gaaactccca gagaataa. It is sometimes possible for the material contained within the vial of "WBSCR28, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
