Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WBSCR22 cdna clone

WBSCR22 cDNA Clone

Gene Names
WBSCR22; WBMT; MERM1; PP3381; HUSSY-3; HASJ4442
Synonyms
WBSCR22; WBSCR22 cDNA Clone; WBSCR22 cdna clone
Ordering
For Research Use Only!
Sequence
atgattgatatccagaccaggatggctgggcgagcattggagcttctttatctgccagagaataagccctgttacctgctggatattggctgtggcactgggctgagtggaagttatctgtcagatgaagggcactattgggtgggcctggatatcagccctgccatgctggatgaggctgtggaccgagagatagagggagacctgctgctgggggatatgggccagggcatcccattcaagccaggcacatttgatggttgcatcagcatttctgctgtgcagtggctctgtaatgctaacaagaagtctgaaaaccctgccaagcgcctgtactgcttttttgcttctcttttttctgttctcgtccggggatcccgagctgtcctgcagctgtaccctgagaactcagagcagttggagctgatcacaacccaggccacaaaggcaggcttctccggtggcatggtggtagactaccctaacagtgccaaagcaaagaaattctacctctgcttgttttctgggccttcgacctttataccagaggggctgagtgaaaatcaggatgaagttgaacccagggagtctgtgttcaccaatgagaggttcccattaaggatgtcgaggcggggaatggtgaggaagagtcgggcatgggtgctggagaagaaggagcggcacaggcgccagggcagggaagtcagacctgacacccagtacaccggccgcaagcgcaagccccgcttctaa
Sequence Length
753
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,846 Da
NCBI Official Full Name
Homo sapiens Williams Beuren syndrome chromosome region 22, mRNA
NCBI Official Synonym Full Names
Williams-Beuren syndrome chromosome region 22
NCBI Official Symbol
WBSCR22
NCBI Official Synonym Symbols
WBMT; MERM1; PP3381; HUSSY-3; HASJ4442
NCBI Protein Information
probable 18S rRNA (guanine-N(7))-methyltransferase
UniProt Protein Name
Probable 18S rRNA (guanine-N(7))-methyltransferase
Protein Family
UniProt Gene Name
WBSCR22
UniProt Synonym Gene Names
MERM1
UniProt Entry Name
WBS22_HUMAN

NCBI Description

This gene encodes a protein containing a nuclear localization signal and an S-adenosyl-L-methionine binding motif typical of methyltransferases, suggesting that the encoded protein may act on DNA methylation. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternatively spliced transcript variants have been found. [provided by RefSeq, Feb 2011]

Uniprot Description

WBSCR22: Methyltransferase that may act on DNA. WBSCR22 is located in the Williams-Beuren syndrome (WBS) critical region. WBS results from a hemizygous deletion of several genes on chromosome 7q11.23, thought to arise as a consequence of unequal crossing over between highly homologous low-copy repeat sequences flanking the deleted region. Haploinsufficiency of WBSCR22 may be the cause of certain cardiovascular and musculo-skeletal abnormalities observed in the disease. Belongs to the methyltransferase superfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Lipid Metabolism - androgen and estrogen; Amino Acid Metabolism - tyrosine; Methyltransferase; Other Amino Acids Metabolism - selenoamino acid; EC 2.1.1.-; Amino Acid Metabolism - histidine

Chromosomal Location of Human Ortholog: 7q11.23

Cellular Component: nucleoplasm

Biological Process: rRNA methylation

Research Articles on WBSCR22

Similar Products

Product Notes

The WBSCR22 wbscr22 (Catalog #AAA1267663) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgattgata tccagaccag gatggctggg cgagcattgg agcttcttta tctgccagag aataagccct gttacctgct ggatattggc tgtggcactg ggctgagtgg aagttatctg tcagatgaag ggcactattg ggtgggcctg gatatcagcc ctgccatgct ggatgaggct gtggaccgag agatagaggg agacctgctg ctgggggata tgggccaggg catcccattc aagccaggca catttgatgg ttgcatcagc atttctgctg tgcagtggct ctgtaatgct aacaagaagt ctgaaaaccc tgccaagcgc ctgtactgct tttttgcttc tcttttttct gttctcgtcc ggggatcccg agctgtcctg cagctgtacc ctgagaactc agagcagttg gagctgatca caacccaggc cacaaaggca ggcttctccg gtggcatggt ggtagactac cctaacagtg ccaaagcaaa gaaattctac ctctgcttgt tttctgggcc ttcgaccttt ataccagagg ggctgagtga aaatcaggat gaagttgaac ccagggagtc tgtgttcacc aatgagaggt tcccattaag gatgtcgagg cggggaatgg tgaggaagag tcgggcatgg gtgctggaga agaaggagcg gcacaggcgc cagggcaggg aagtcagacc tgacacccag tacaccggcc gcaagcgcaa gccccgcttc taa. It is sometimes possible for the material contained within the vial of "WBSCR22, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.