WBP11 cdna clone
WBP11 cDNA Clone
Gene Names
WBP11; NPWBP; SIPP1; WBP-11; PPP1R165
Synonyms
WBP11; WBP11 cDNA Clone; WBP11 cdna clone
Sequence
atgggacggagatctacatcatccaccaagagtggaaaatttatgaaccccacagaccaagcccgaaaggaagcccggaagagagaattaaagaagaacaaaaaacagcgcatgatggttcgagctgcagttttaaagatgaaggatccaaaacagataatccgagacatggagaaattggatgaaatggagtttaacccagtgcaacagccacaattaaatgagaaagtactgaaagacaagcgtaaaaagctgcgtgaaacctttgaacgtattctacgactctatgaaaaagagaatccagatatttacaaagaattgagaaagctagaagtagaatatgaacagaagagggctcaacttagccaatattttgatgctgtcaagaatgctcagcatgtggaagtggagagtattcctttgccagatatgccacatgctccttccaacattttgatccaggacattccacttcctggtgcccagccaccctctatcctaaagaaaacctcagcctatggacctccaactcgggcagtttctatccttcctcttcttggacatggtgttccacgtttgccccctggcagaaaacctcctggccctccccctggtccacctcctcctcaagtcgtgcagatgtatggccgtaaagtgggttttgccctagatcttccccctcgtaggcgagatgaagacatgttatatagtcctgaacttgcccagcgaggtcatgatgatgatgtttctagcaccagtgaagatgatggctatcctgaggacatggatcaagataagcatgatgacagtactgatgacagtgacaccgacaaatcagatggagaaagtgacggggatgaatttgtgcaccgtgataatggtgagagagacaacaatgaagaaaagaagtcaggtctgagtgtacggtttgcagatatgcctggaaaatcaaggaagaaaaagaagaacatgaaggaactgactcctcttcaagccatgatgcttcgtatggcaggtcaagaaatccctgaggagggacgggaagtagaggaattttcagaggacgatgatgaagatgattctgatgactctgaagcagaaaagcaatcacaaaagcagcataaagaggaatcccattctgatggcacatccactgcttcttcacagcagcaggctccgccgcagtctgttcctccttctcagatacaagcacctcccatgccaggaccaccacctcttggaccaccacctgctccaccattacggcctcctgggccacctacaggccttcctcctggtccacctccaggagctcctccattcctgagaccacctggaatgccaggactccgagggcccttaccccgacttttacctccaggaccaccaccaggccgaccccctggccctcccccaggtccacctccaggtctgcctcctggtccccctcctcgtggacccccaccaaggctacctccccctgcacctccaggtattcctccacctcgtcctggcatgatgcgcccacctttggtgcctccccttggacctgccccccctgggctgttcccaccagctcccttgccaaaccctggggttttaagtgccccacccaacttgattcagcgacccaaggcggatgatacaagtgcagccaccattgagaagaaagccacagcaaccatcagtgccaagccacagatcactaatcccaaggcagagattactcgatttgtgcccactgcactgagagtacgtcgggagaataaaggggctactgctgctccccaaagaaagtcagaggatgattctgctgtgcctcttgccaaagcagcacccaaatctggtccttctgttcctgtctcagtacaaactaaggatgatgtctatgaggctttcatgaaagagatggaagggctactgtga
Sequence Length
1926
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
69,998 Da
NCBI Official Full Name
Homo sapiens WW domain binding protein 11, mRNA
NCBI Official Synonym Full Names
WW domain binding protein 11
NCBI Official Symbol
WBP11
NCBI Official Synonym Symbols
NPWBP; SIPP1; WBP-11; PPP1R165
NCBI Protein Information
WW domain-binding protein 11
UniProt Protein Name
WW domain-binding protein 11
Protein Family
UniProt Gene Name
WBP11
UniProt Synonym Gene Names
NPWBP; SIPP1; SNP70; WBP-11; NpwBP
UniProt Entry Name
WBP11_HUMAN
NCBI Description
This gene encodes a nuclear protein, which colocalizes with mRNA splicing factors and intermediate filament-containing perinuclear networks. This protein has 95% amino acid sequence identity to the mouse Wbp11 protein. It contains two proline-rich regions that bind to the WW domain of Npw38, a nuclear protein, and thus this protein is also called Npw38-binding protein NpwBP. The Npw38-NpwBP complex may function as a component of an mRNA factory in the nucleus. [provided by RefSeq, Jul 2008]
Uniprot Description
WBP11: Activates pre-mRNA splicing. May inhibit PP1 phosphatase activity.
Protein type: Protein phosphatase, regulatory subunit; RNA processing; DNA-binding; Spliceosome
Chromosomal Location of Human Ortholog: 12p12.3
Cellular Component: cytoplasm; intracellular membrane-bound organelle; nucleoplasm; nucleus; spliceosome
Molecular Function: protein binding; single-stranded DNA binding; WW domain binding
Biological Process: nuclear mRNA cis splicing, via U2-type spliceosome
Research Articles on WBP11
1. SIPP1 is a positive regulator of pre-mRNA splicing that is regulated by nucleocytoplasmic shuttling
Similar Products
Product Notes
The WBP11 wbp11 (Catalog #AAA1267264) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggacgga gatctacatc atccaccaag agtggaaaat ttatgaaccc cacagaccaa gcccgaaagg aagcccggaa gagagaatta aagaagaaca aaaaacagcg catgatggtt cgagctgcag ttttaaagat gaaggatcca aaacagataa tccgagacat ggagaaattg gatgaaatgg agtttaaccc agtgcaacag ccacaattaa atgagaaagt actgaaagac aagcgtaaaa agctgcgtga aacctttgaa cgtattctac gactctatga aaaagagaat ccagatattt acaaagaatt gagaaagcta gaagtagaat atgaacagaa gagggctcaa cttagccaat attttgatgc tgtcaagaat gctcagcatg tggaagtgga gagtattcct ttgccagata tgccacatgc tccttccaac attttgatcc aggacattcc acttcctggt gcccagccac cctctatcct aaagaaaacc tcagcctatg gacctccaac tcgggcagtt tctatccttc ctcttcttgg acatggtgtt ccacgtttgc cccctggcag aaaacctcct ggccctcccc ctggtccacc tcctcctcaa gtcgtgcaga tgtatggccg taaagtgggt tttgccctag atcttccccc tcgtaggcga gatgaagaca tgttatatag tcctgaactt gcccagcgag gtcatgatga tgatgtttct agcaccagtg aagatgatgg ctatcctgag gacatggatc aagataagca tgatgacagt actgatgaca gtgacaccga caaatcagat ggagaaagtg acggggatga atttgtgcac cgtgataatg gtgagagaga caacaatgaa gaaaagaagt caggtctgag tgtacggttt gcagatatgc ctggaaaatc aaggaagaaa aagaagaaca tgaaggaact gactcctctt caagccatga tgcttcgtat ggcaggtcaa gaaatccctg aggagggacg ggaagtagag gaattttcag aggacgatga tgaagatgat tctgatgact ctgaagcaga aaagcaatca caaaagcagc ataaagagga atcccattct gatggcacat ccactgcttc ttcacagcag caggctccgc cgcagtctgt tcctccttct cagatacaag cacctcccat gccaggacca ccacctcttg gaccaccacc tgctccacca ttacggcctc ctgggccacc tacaggcctt cctcctggtc cacctccagg agctcctcca ttcctgagac cacctggaat gccaggactc cgagggccct taccccgact tttacctcca ggaccaccac caggccgacc ccctggccct cccccaggtc cacctccagg tctgcctcct ggtccccctc ctcgtggacc cccaccaagg ctacctcccc ctgcacctcc aggtattcct ccacctcgtc ctggcatgat gcgcccacct ttggtgcctc cccttggacc tgccccccct gggctgttcc caccagctcc cttgccaaac cctggggttt taagtgcccc acccaacttg attcagcgac ccaaggcgga tgatacaagt gcagccacca ttgagaagaa agccacagca accatcagtg ccaagccaca gatcactaat cccaaggcag agattactcg atttgtgccc actgcactga gagtacgtcg ggagaataaa ggggctactg ctgctcccca aagaaagtca gaggatgatt ctgctgtgcc tcttgccaaa gcagcaccca aatctggtcc ttctgttcct gtctcagtac aaactaagga tgatgtctat gaggctttca tgaaagagat ggaagggcta ctgtga. It is sometimes possible for the material contained within the vial of "WBP11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
