Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

VPS11 cdna clone

VPS11 cDNA Clone

Gene Names
VPS11; END1; PEP5; HLD12; RNF108; hVPS11
Synonyms
VPS11; VPS11 cDNA Clone; VPS11 cdna clone
Ordering
For Research Use Only!
Sequence
atgagtgaagtgcagccagactcaccccaggggatctacgacacactccttgagctgcgactgcagaactgggcccacgagaaggatccacaggtcaaagagaagcttcacgcagaggccatttccctgctgaagagtggtcgcttctgtgacgtctttgacaaggccctggtcctgtgccagatgcacgacttccaggatggtgtcctttacctttatgagcaggggaagctgttccagcagatcatgcactaccacatgcagcacgagcagtaccggcaggtcatcagcgtgtgtgagcgccatggggagcaggacccctccttgtgggagcaggccctcagctacttcgctcgcaaggaggaggactgcaaggagtatgtggcagctgtcctcaagcatatcgagaacaagaacctcatgccacctcttctagtggtgcagaccctggcccacaactccacagccacactctccgtcatcagggactacctggtccaaaaactacagaaacagagccagcagattgcacaggatgagctgcgggtgcggcggtaccgagaggagaccacccgtatccgccaggagatccaagagctcaaggccagtcctaagattttccaaaagaccaagtgcagcatctgtaacagtgccttggagttgccctcagtccacttcctgtgtggccactccttccaccaacactgctttgagagttactcggaaagtgatgctgactgccccacctgcctccctgaaaaccggaaggtcatggatatgatccgggcccaggaacagaaacgagatctccatgatcaattccagcatcagctcaggtgctccaatgacagcttttctgtgattgctgactactttggcagaggtgttttcaacaaattgactctgctgaccgaccctcccacagccagactgacctccagcctggaggctgggctgcaacgcgacctactcatgcactccaggaggggcacttaa
Sequence Length
996
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
107,837 Da
NCBI Official Full Name
Homo sapiens vacuolar protein sorting 11 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
VPS11, CORVET/HOPS core subunit
NCBI Official Symbol
VPS11
NCBI Official Synonym Symbols
END1; PEP5; HLD12; RNF108; hVPS11
NCBI Protein Information
vacuolar protein sorting-associated protein 11 homolog
UniProt Protein Name
Vacuolar protein sorting-associated protein 11 homolog
UniProt Gene Name
VPS11
UniProt Synonym Gene Names
RNF108; hVPS11
UniProt Entry Name
VPS11_HUMAN

NCBI Description

Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps11 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]

Uniprot Description

VPS11: May play a role in vesicle-mediated protein trafficking to lysosomal compartments and in membrane docking/fusion reactions of late endosomes/lysosomes. Belongs to the VPS11 family.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 11q23

Cellular Component: early endosome; endocytic vesicle; endosome; late endosome; lysosomal membrane; lysosome

Molecular Function: protein binding; protein binding, bridging; protein domain specific binding; syntaxin binding

Biological Process: endosomal vesicle fusion; endosome organization and biogenesis; endosome to lysosome transport; lysosome organization and biogenesis; regulation of protein stability; vesicle docking during exocytosis

Disease: Leukodystrophy, Hypomyelinating, 12

Research Articles on VPS11

Similar Products

Product Notes

The VPS11 vps11 (Catalog #AAA1271054) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtgaag tgcagccaga ctcaccccag gggatctacg acacactcct tgagctgcga ctgcagaact gggcccacga gaaggatcca caggtcaaag agaagcttca cgcagaggcc atttccctgc tgaagagtgg tcgcttctgt gacgtctttg acaaggccct ggtcctgtgc cagatgcacg acttccagga tggtgtcctt tacctttatg agcaggggaa gctgttccag cagatcatgc actaccacat gcagcacgag cagtaccggc aggtcatcag cgtgtgtgag cgccatgggg agcaggaccc ctccttgtgg gagcaggccc tcagctactt cgctcgcaag gaggaggact gcaaggagta tgtggcagct gtcctcaagc atatcgagaa caagaacctc atgccacctc ttctagtggt gcagaccctg gcccacaact ccacagccac actctccgtc atcagggact acctggtcca aaaactacag aaacagagcc agcagattgc acaggatgag ctgcgggtgc ggcggtaccg agaggagacc acccgtatcc gccaggagat ccaagagctc aaggccagtc ctaagatttt ccaaaagacc aagtgcagca tctgtaacag tgccttggag ttgccctcag tccacttcct gtgtggccac tccttccacc aacactgctt tgagagttac tcggaaagtg atgctgactg ccccacctgc ctccctgaaa accggaaggt catggatatg atccgggccc aggaacagaa acgagatctc catgatcaat tccagcatca gctcaggtgc tccaatgaca gcttttctgt gattgctgac tactttggca gaggtgtttt caacaaattg actctgctga ccgaccctcc cacagccaga ctgacctcca gcctggaggc tgggctgcaa cgcgacctac tcatgcactc caggaggggc acttaa. It is sometimes possible for the material contained within the vial of "VPS11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.