Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

VHLL cdna clone

VHLL cDNA Clone

Gene Names
VHLL; VLP; VHLP
Synonyms
VHLL; VHLL cDNA Clone; VHLL cdna clone
Ordering
For Research Use Only!
Sequence
atgccctggagagcggggaacggggtgggtttagaggcccaggcgggcacccaggaggcaggcccagaagagtactgccaggaagagttgggcgccgaggaggagatggcagccagagcagcatggcctgtgctgcgctctgtgaactcacgcgagctctcccggatcatcatctgcaatcacagcccacgaatcgtgctgcctgtgtggctcaactactatggcaagctgctgccctacctgacgctgctgcccggcagggacttccgcatccacaacttccgaagccacccttggctcttcagagatgcaaggacacatgataagcttctggttaaccaaactgaattgtttgtgccatcttccaatgttaatggacagcctgtttttgccaacatcacactgcagtgtataccctga
Sequence Length
420
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,781 Da
NCBI Official Full Name
Homo sapiens von Hippel-Lindau tumor suppressor-like, mRNA
NCBI Official Synonym Full Names
von Hippel-Lindau tumor suppressor like
NCBI Official Symbol
VHLL
NCBI Official Synonym Symbols
VLP; VHLP
NCBI Protein Information
von Hippel-Lindau-like protein
UniProt Protein Name
Von Hippel-Lindau-like protein
UniProt Gene Name
VHLL
UniProt Synonym Gene Names
VLP; VHL-like protein; VLP
UniProt Entry Name
VHLL_HUMAN

NCBI Description

Von Hippel-Lindau (VHL) tumor suppressor protein is a component of an E3 ubiquitin ligase complex that selectively ubiquitinates the alpha subunit of the hypoxia-inducible factor (HIF) transcription factor for proteasome-mediated degradation. Inactivation of VHL causes VHL disease and sporadic kidney cancer. This gene encodes a VHL homolog that lacks one of two key domains necessary for VHL function. This gene may contribute to the regulation of oxygen homeostasis and neovascularization during placenta development. This gene is intronless, and can also be interpreted as a retrotransposed pseudogene of the VHL locus located on chromosome 3. However, the protein is represented in this RefSeq due to evidence in PMID:14757845 that strongly suggests it is translated. The same publication also indicates that this protein binds HIF alpha but fails to recruit the E3 ubiquitin ligase complex, and it therefore functions as a dominant-negative VHL protein and a protector of HIF alpha. [provided by RefSeq, Jan 2010]

Uniprot Description

VHLL: Functions as a dominant-negative VHL to serve as a protector of HIFalpha.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 1q22

Cellular Component: nucleus; VCB complex

Molecular Function: protein binding

Biological Process: protein ubiquitination

Similar Products

Product Notes

The VHLL vhll (Catalog #AAA1266427) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccctgga gagcggggaa cggggtgggt ttagaggccc aggcgggcac ccaggaggca ggcccagaag agtactgcca ggaagagttg ggcgccgagg aggagatggc agccagagca gcatggcctg tgctgcgctc tgtgaactca cgcgagctct cccggatcat catctgcaat cacagcccac gaatcgtgct gcctgtgtgg ctcaactact atggcaagct gctgccctac ctgacgctgc tgcccggcag ggacttccgc atccacaact tccgaagcca cccttggctc ttcagagatg caaggacaca tgataagctt ctggttaacc aaactgaatt gtttgtgcca tcttccaatg ttaatggaca gcctgttttt gccaacatca cactgcagtg tataccctga. It is sometimes possible for the material contained within the vial of "VHLL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.