VAT1 cdna clone
VAT1 cDNA Clone
Gene Names
VAT1; VATI
Synonyms
VAT1; VAT1 cDNA Clone; VAT1 cdna clone
Sequence
atgtccgacgagagagaggtagccgaggcagcgaccggggaagacgcctcttcgccgcctccgaaaaccgaggcagcgagcgacccccagcatcccgcggcctccgaaggggccgccgccgccgccgcctcgccgccactgctgcgctgcctagtgctcaccggctttggaggctacgacaaggtgaagctgcagagccggccggcagcgcccccggcccctgggcccggccagctgacgctgcgtctgcgggcctgcgggctcaacttcgcagacctcatggctaggcaggggctgtacgaccgtctcccgcctctgcctgtcactccgggcatggagggcgcgggtgttgtgatcgcagtgggcgagggagtcagcgaccgcaaggcaggagaccgggtgatggtgttgaaccggtcagggatgtggcaggaagaggtgactgtgccctcggtccagaccttcctgattcctgaggccatgacctttgaggaagctgctgccttgctcgtcaattacattacagcctacatggtcctctttgacttcggcaacctacagcctggccacagcgtcttggtacacatggctgcagggggtgtgggtatggctgccgtgcagctgtgccgtacagtggagaatgtgacagtgttcggaacggcctcggccagcaagcacgaggcactgaaggagaatggggtcacacatcccatcgactatcacacgactgactacgtggatgagatcaagaagatttcccctaaaggagtggacattgtcatggaccctctgggtgggtcagatactgccaagggctacaacctcctgaaacccatgggcaaagtcgtcacctatggaatggccaacctgctgacgggccccaaacggaacctgatggccctggcccggacatggtggaatcagttcagcgtgacagctctgcagctgctgcaggccaaccgggctgtgtgtggcttccacctgggctacctggatggtgaggtggagctggtcagtggtgtggtggcccgcctcctggctctgtacaaccagggccacatcaagccccacattgactcagtctggcccttcgagaaggtggctgatgccatgaaacagatgcaggagaagaagaatgtgggcaaggtcctcctggttccagggccagagaaggagaactag
Sequence Length
1182
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
34,890 Da
NCBI Official Full Name
Homo sapiens vesicle amine transport protein 1 homolog (T. californica), mRNA
NCBI Official Synonym Full Names
vesicle amine transport 1
NCBI Official Symbol
VAT1
NCBI Official Synonym Symbols
VATI
NCBI Protein Information
synaptic vesicle membrane protein VAT-1 homolog
UniProt Protein Name
Synaptic vesicle membrane protein VAT-1 homolog
Protein Family
UniProt Gene Name
VAT1
UniProt Entry Name
VAT1_HUMAN
NCBI Description
Synaptic vesicles are responsible for regulating the storage and release of neurotransmitters in the nerve terminal. The protein encoded by this gene is an abundant integral membrane protein of cholinergic synaptic vesicles and is thought to be involved in vesicular transport. It belongs to the quinone oxidoreductase subfamily of zinc-containing alcohol dehydrogenase proteins. [provided by RefSeq, Jul 2008]
Uniprot Description
VAT1: Possesses ATPase activity. Plays a part in calcium-regulated keratinocyte activation in epidermal repair mechanisms. Has no effect on cell proliferation. Negatively regulates mitochondrial fusion in cooperation with mitofusin proteins (MFN1-2). Belongs to the zinc-containing alcohol dehydrogenase family. Quinone oxidoreductase subfamily.
Protein type: Membrane protein, integral; Oxidoreductase; EC 1.-.-.-
Chromosomal Location of Human Ortholog: 17q21
Cellular Component: integral to membrane
Research Articles on VAT1
Similar Products
Product Notes
The VAT1 vat1 (Catalog #AAA1269284) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccgacg agagagaggt agccgaggca gcgaccgggg aagacgcctc ttcgccgcct ccgaaaaccg aggcagcgag cgacccccag catcccgcgg cctccgaagg ggccgccgcc gccgccgcct cgccgccact gctgcgctgc ctagtgctca ccggctttgg aggctacgac aaggtgaagc tgcagagccg gccggcagcg cccccggccc ctgggcccgg ccagctgacg ctgcgtctgc gggcctgcgg gctcaacttc gcagacctca tggctaggca ggggctgtac gaccgtctcc cgcctctgcc tgtcactccg ggcatggagg gcgcgggtgt tgtgatcgca gtgggcgagg gagtcagcga ccgcaaggca ggagaccggg tgatggtgtt gaaccggtca gggatgtggc aggaagaggt gactgtgccc tcggtccaga ccttcctgat tcctgaggcc atgacctttg aggaagctgc tgccttgctc gtcaattaca ttacagccta catggtcctc tttgacttcg gcaacctaca gcctggccac agcgtcttgg tacacatggc tgcagggggt gtgggtatgg ctgccgtgca gctgtgccgt acagtggaga atgtgacagt gttcggaacg gcctcggcca gcaagcacga ggcactgaag gagaatgggg tcacacatcc catcgactat cacacgactg actacgtgga tgagatcaag aagatttccc ctaaaggagt ggacattgtc atggaccctc tgggtgggtc agatactgcc aagggctaca acctcctgaa acccatgggc aaagtcgtca cctatggaat ggccaacctg ctgacgggcc ccaaacggaa cctgatggcc ctggcccgga catggtggaa tcagttcagc gtgacagctc tgcagctgct gcaggccaac cgggctgtgt gtggcttcca cctgggctac ctggatggtg aggtggagct ggtcagtggt gtggtggccc gcctcctggc tctgtacaac cagggccaca tcaagcccca cattgactca gtctggccct tcgagaaggt ggctgatgcc atgaaacaga tgcaggagaa gaagaatgtg ggcaaggtcc tcctggttcc agggccagag aaggagaact ag. It is sometimes possible for the material contained within the vial of "VAT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
