VARS2 cdna clone
VARS2 cDNA Clone
Gene Names
VARS2; VALRS; VARSL; VARS2L; COXPD20
Synonyms
VARS2; VARS2 cDNA Clone; VARS2 cdna clone
Sequence
atgcctcatttgcctctcgcctcttttcgaccaccattttgggggctgaggcactcacggggcctccccaggtttcactccgtttctacacagtcggagccccatggatctcccatctcccggaggaaccgtgaagccaaacagaagcgcctgcgagagaagcaggcgactctggaggctgagatagcaggggagagcaagtcacctgcagaatccattaaggcctggaggcctaaggagttagtattgtatgaaatccctacgaaacccggtgaaaagaaagatgtctctgggcccctgcctcctgcatacagcccccgatatgttgaggctgcctggtacccgtggtgggtacgagagggcttcttcaaaccagaatatcaggcccggctgccccaagctacaggggagaccttttccatgtgtatcccacctcccaatgtcactggctccctgcacattggccacgcactcacggtggccatacaggatgccctcgtgcgctggcaccggatgcgtggggatcaagtgctgtgggtccctggttcagatcatgcaggaattgctacacaagctgtggtggagaaacaactgtggaaggaacggggagtgaggagacatgagctgagccgggaggccttccttagggaggtgtggcagtggaaggaggcgaaaggtggagagatctgtgagcagctgcgagctctgggtgcctccctggactgggatcgagagtgttttaccatggatgttggctcctcagtggctgtgactgaagcttttgtgcggctctacaaggcggggttgctgtaccggaaccatcagcttgtcaactggtcatgtgctttaagatcagccatctcggacattgaggtggagaaccggcccctgcctggccacacacagcttcgactgcctggctgccccacccccgtgtcttttggcctcctattttctgttgccttccccgtggatggagagcctgatgcagaggttgtggtaggaaccacaaggccagagacgctgcctggagatgtggctgtggccgttcatccagacgactcgcgatacacacatctacacgggcgacagcttcgtcaccccttgatggggcagcctcttcccctcatcacagactatgctgttcagccacatgtgggcacgggggcagtgaaggtgactccagctcacagtcctgccgatgctgagatgggggcccgacatggcttgagccccttgaatgtcattgcggaggatgggaccatgacctctctctgcggggactggctgcagggtcttcaccggtttgtggcccgggaaaagataatgtctgtgctgagtgaacggggcctgttccggggcctccagaaccaccccatggtactgcccatctgcagccgttctggggatgtgatagaatacctgctgaagaaccagtggtttgtccgctgccaggaaatgggggcccgagctgccaaggctgtggagtcgggggccctggagctcagtccctccttccaccagaagaactggcagcactggttttcccatattggggactggtgtgtctcccggcagctgtggtggggccatcagattccagcctacctggttgtagaggaccatgcgcagggagaagaggactgttgggtggtcgggcggtcagaggctgaggccagagaggtagcagcggaactgacagggaggccaggggcagagctgaccctggagagggatcctgatgtcctagacacatggttttcttctgccctgttccccttttctgccctgggctggccccaagagaccccagaccttgctcgtttctaccccctgtcacttttggaaacgggcagcgaccttctgctgttctgggtgggccgcatggtcatgttggggacccagctcacagggcagctgcccttcagcaaggtgcttcttcatcccatggttcgggacaggcagggccggaagatgagcaagtccctggggaatgtgctggacccaagagacatcatcagtggggtggagatgcaggtgctgcaggaaaagctgagaagcggaaatttggaccctgcagagctggccattgtggctgcagcacagaaaaaggactttcctcacgggatccctgagtgtgggacagatgccctgagattcacactctgctcccatggagttcaggcgggcgacttgcacctgtcagtctctgaggtccagagctgccgacatttctgcaacaagatctggaatgctcttcgctttatcctcaatgctttaggggagaaatttgtgccacagcctgctgaggagctgtctccctcctccccgatggatgcctggatcctgagccgccttgccctggctgcccaggagtgtgagcggggcttcctcacccgagagctctcgctcgtcactcatgccctgcaccacttctggcttcacaacctctgtgacgtctacctggaggctgtgaagcccgtgctgtggcactcgccccgccccctggggccccctcaggtcctgttctcctgcgctgacctcggcctccgcctcctggccccactgatgcccttcctggctgaagagctctggcagaggctgccccccaggcctggttgcccccctgcccccagcatctcggttgccccctaccccagcgcctgcagcttggagcactggcgccagccagagctggagcggcgcttctcccgggtccaagaggtcgtgcaggtgctaagggctctccaagccacgtaccagctcaccaaagcccggccccgagtgctgctgcagagctcagagcctggggaccagggcctcttcgaggccttcttggagcccctgggcaccctgggctactgtggggctgtgggcctgttacccccaggcgcagcagctccctccggctgggcccaggctccactcagtgacacggctcaagtctacatggagctgcagggcctggtggacccgcagatccagctacctctgttagccgcccgaaggtacaagttgcagaagcagcttgatagcctcacagccaggaccccatcagaaggggaggcagggactcagaggcaacaaaagctttcttccctccagctggaattgtcaaaactggacaaggcagcctctcacctccggcagctgatggatgagcctccagccccagggagcccggagctctaa
Sequence Length
3192
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
121,543 Da
NCBI Official Full Name
Homo sapiens valyl-tRNA synthetase 2, mitochondrial (putative), mRNA
NCBI Official Synonym Full Names
valyl-tRNA synthetase 2, mitochondrial
NCBI Official Symbol
VARS2
NCBI Official Synonym Symbols
VALRS; VARSL; VARS2L; COXPD20
NCBI Protein Information
valine--tRNA ligase, mitochondrial
UniProt Protein Name
Valine--tRNA ligase, mitochondrial
UniProt Gene Name
VARS2
UniProt Synonym Gene Names
KIAA1885; VARS2L; VARSL; ValRS
UniProt Entry Name
SYVM_HUMAN
NCBI Description
This gene encodes a mitochondrial aminoacyl-tRNA synthetase, which catalyzes the attachment of valine to tRNA(Val) for mitochondrial translation. Mutations in this gene cause combined oxidative phosphorylation deficiency-20, and are also associated with early-onset mitochondrial encephalopathies. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Uniprot Description
VARS2: Belongs to the class-I aminoacyl-tRNA synthetase family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Translation; EC 6.1.1.9; Amino Acid Metabolism - valine, leucine and isoleucine biosynthesis; Ligase
Chromosomal Location of Human Ortholog: 6p21.33
Cellular Component: cytosol
Molecular Function: valine-tRNA ligase activity
Biological Process: valyl-tRNA aminoacylation
Disease: Combined Oxidative Phosphorylation Deficiency 20
Research Articles on VARS2
Similar Products
Product Notes
The VARS2 vars2 (Catalog #AAA1272325) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctcatt tgcctctcgc ctcttttcga ccaccatttt gggggctgag gcactcacgg ggcctcccca ggtttcactc cgtttctaca cagtcggagc cccatggatc tcccatctcc cggaggaacc gtgaagccaa acagaagcgc ctgcgagaga agcaggcgac tctggaggct gagatagcag gggagagcaa gtcacctgca gaatccatta aggcctggag gcctaaggag ttagtattgt atgaaatccc tacgaaaccc ggtgaaaaga aagatgtctc tgggcccctg cctcctgcat acagcccccg atatgttgag gctgcctggt acccgtggtg ggtacgagag ggcttcttca aaccagaata tcaggcccgg ctgccccaag ctacagggga gaccttttcc atgtgtatcc cacctcccaa tgtcactggc tccctgcaca ttggccacgc actcacggtg gccatacagg atgccctcgt gcgctggcac cggatgcgtg gggatcaagt gctgtgggtc cctggttcag atcatgcagg aattgctaca caagctgtgg tggagaaaca actgtggaag gaacggggag tgaggagaca tgagctgagc cgggaggcct tccttaggga ggtgtggcag tggaaggagg cgaaaggtgg agagatctgt gagcagctgc gagctctggg tgcctccctg gactgggatc gagagtgttt taccatggat gttggctcct cagtggctgt gactgaagct tttgtgcggc tctacaaggc ggggttgctg taccggaacc atcagcttgt caactggtca tgtgctttaa gatcagccat ctcggacatt gaggtggaga accggcccct gcctggccac acacagcttc gactgcctgg ctgccccacc cccgtgtctt ttggcctcct attttctgtt gccttccccg tggatggaga gcctgatgca gaggttgtgg taggaaccac aaggccagag acgctgcctg gagatgtggc tgtggccgtt catccagacg actcgcgata cacacatcta cacgggcgac agcttcgtca ccccttgatg gggcagcctc ttcccctcat cacagactat gctgttcagc cacatgtggg cacgggggca gtgaaggtga ctccagctca cagtcctgcc gatgctgaga tgggggcccg acatggcttg agccccttga atgtcattgc ggaggatggg accatgacct ctctctgcgg ggactggctg cagggtcttc accggtttgt ggcccgggaa aagataatgt ctgtgctgag tgaacggggc ctgttccggg gcctccagaa ccaccccatg gtactgccca tctgcagccg ttctggggat gtgatagaat acctgctgaa gaaccagtgg tttgtccgct gccaggaaat gggggcccga gctgccaagg ctgtggagtc gggggccctg gagctcagtc cctccttcca ccagaagaac tggcagcact ggttttccca tattggggac tggtgtgtct cccggcagct gtggtggggc catcagattc cagcctacct ggttgtagag gaccatgcgc agggagaaga ggactgttgg gtggtcgggc ggtcagaggc tgaggccaga gaggtagcag cggaactgac agggaggcca ggggcagagc tgaccctgga gagggatcct gatgtcctag acacatggtt ttcttctgcc ctgttcccct tttctgccct gggctggccc caagagaccc cagaccttgc tcgtttctac cccctgtcac ttttggaaac gggcagcgac cttctgctgt tctgggtggg ccgcatggtc atgttgggga cccagctcac agggcagctg cccttcagca aggtgcttct tcatcccatg gttcgggaca ggcagggccg gaagatgagc aagtccctgg ggaatgtgct ggacccaaga gacatcatca gtggggtgga gatgcaggtg ctgcaggaaa agctgagaag cggaaatttg gaccctgcag agctggccat tgtggctgca gcacagaaaa aggactttcc tcacgggatc cctgagtgtg ggacagatgc cctgagattc acactctgct cccatggagt tcaggcgggc gacttgcacc tgtcagtctc tgaggtccag agctgccgac atttctgcaa caagatctgg aatgctcttc gctttatcct caatgcttta ggggagaaat ttgtgccaca gcctgctgag gagctgtctc cctcctcccc gatggatgcc tggatcctga gccgccttgc cctggctgcc caggagtgtg agcggggctt cctcacccga gagctctcgc tcgtcactca tgccctgcac cacttctggc ttcacaacct ctgtgacgtc tacctggagg ctgtgaagcc cgtgctgtgg cactcgcccc gccccctggg gccccctcag gtcctgttct cctgcgctga cctcggcctc cgcctcctgg ccccactgat gcccttcctg gctgaagagc tctggcagag gctgcccccc aggcctggtt gcccccctgc ccccagcatc tcggttgccc cctaccccag cgcctgcagc ttggagcact ggcgccagcc agagctggag cggcgcttct cccgggtcca agaggtcgtg caggtgctaa gggctctcca agccacgtac cagctcacca aagcccggcc ccgagtgctg ctgcagagct cagagcctgg ggaccagggc ctcttcgagg ccttcttgga gcccctgggc accctgggct actgtggggc tgtgggcctg ttacccccag gcgcagcagc tccctccggc tgggcccagg ctccactcag tgacacggct caagtctaca tggagctgca gggcctggtg gacccgcaga tccagctacc tctgttagcc gcccgaaggt acaagttgca gaagcagctt gatagcctca cagccaggac cccatcagaa ggggaggcag ggactcagag gcaacaaaag ctttcttccc tccagctgga attgtcaaaa ctggacaagg cagcctctca cctccggcag ctgatggatg agcctccagc cccagggagc ccggagctct aa. It is sometimes possible for the material contained within the vial of "VARS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
