Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UTP11L cdna clone

UTP11L cDNA Clone

Gene Names
UTP11; CGI94; CGI-94; UTP11L
Synonyms
UTP11L; UTP11L cDNA Clone; UTP11L cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggcttttcggaaggcggctaagtcccggcagcgggaacacagagagcgaagccagcctggctttcgaaaacatctgggcctgctggagaaaaagaaagattacaaacttcgtgcagatgactaccgtaaaaaacaagaatacctcaaagctcttcggaagaaggctcttgaaaaaaatccagatgaattctactacaaaatgactcgggttaaactccaggatggagtacatattattaaggagactaaggaagaagtaaccccagaacaactaaagctgatgagaactcaggacgtcaaatatatagaaatgaagagggttgcagaagctaagaaaatcgaaagactaaaatcagagctccatctgctggatttccaggggaagcaacagaacaagcatgtgttcttttttgacaccaaaaaggaagttgaacagtttgatgtcgcaactcacctgcaaacagccccggagctagtcgacagagtctttaataggcccaggatagagaccttgcagaaagaaaaagtgaaaggagttaccaatcagactggacttaagcggatagctaaagaaaggcaaaagcagtataactgcctgacacagcggattgaacgagagaagaaattgttcgttattgctcagaaaattcaaacacgcaaagatcttatggataaaactcagaaagtgaaggtgaagaaagaaacggtgaactccccagctatttataaatttcagagtcgtcgaaaacgttga
Sequence Length
762
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,869 Da
NCBI Official Full Name
Homo sapiens UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast), mRNA
NCBI Official Synonym Full Names
UTP11, small subunit processome component homolog (S. cerevisiae)
NCBI Official Symbol
UTP11
NCBI Official Synonym Symbols
CGI94; CGI-94; UTP11L
NCBI Protein Information
probable U3 small nucleolar RNA-associated protein 11
UniProt Protein Name
Probable U3 small nucleolar RNA-associated protein 11
UniProt Gene Name
UTP11
UniProt Synonym Gene Names
U3 snoRNA-associated protein 11
UniProt Entry Name
UTP11_HUMAN

Uniprot Description

UTP11L: Involved in nucleolar processing of pre-18S ribosomal RNA. Belongs to the UTP11 family.

Protein type: RNA-binding; Nucleolus

Chromosomal Location of Human Ortholog: 1p34.3

Cellular Component: cytoplasm; extracellular space; nucleolus; nucleoplasm; small subunit processome

Molecular Function: protein binding

Biological Process: nervous system development; positive regulation of apoptosis; ribosomal small subunit biogenesis and assembly; rRNA processing

Research Articles on UTP11L

Similar Products

Product Notes

The UTP11L utp11 (Catalog #AAA1277396) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg cttttcggaa ggcggctaag tcccggcagc gggaacacag agagcgaagc cagcctggct ttcgaaaaca tctgggcctg ctggagaaaa agaaagatta caaacttcgt gcagatgact accgtaaaaa acaagaatac ctcaaagctc ttcggaagaa ggctcttgaa aaaaatccag atgaattcta ctacaaaatg actcgggtta aactccagga tggagtacat attattaagg agactaagga agaagtaacc ccagaacaac taaagctgat gagaactcag gacgtcaaat atatagaaat gaagagggtt gcagaagcta agaaaatcga aagactaaaa tcagagctcc atctgctgga tttccagggg aagcaacaga acaagcatgt gttctttttt gacaccaaaa aggaagttga acagtttgat gtcgcaactc acctgcaaac agccccggag ctagtcgaca gagtctttaa taggcccagg atagagacct tgcagaaaga aaaagtgaaa ggagttacca atcagactgg acttaagcgg atagctaaag aaaggcaaaa gcagtataac tgcctgacac agcggattga acgagagaag aaattgttcg ttattgctca gaaaattcaa acacgcaaag atcttatgga taaaactcag aaagtgaagg tgaagaaaga aacggtgaac tccccagcta tttataaatt tcagagtcgt cgaaaacgtt ga. It is sometimes possible for the material contained within the vial of "UTP11L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.