Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

USP48 cdna clone

USP48 cDNA Clone

Gene Names
USP48; USP31; RAP1GA1
Synonyms
USP48; USP48 cDNA Clone; USP48 cdna clone
Ordering
For Research Use Only!
Sequence
atggccccgcggctgcagctggagaaggcggcctggcgctgggcggagacggtgcggcccgaggaggtgtcgcaggagcacatcgagaccgcttaccgcatctggctggagccctgcattcgcggcgtgtgcagacgaaactgcaaaggaaatccgaattgcttggttggtattggtgagcatatttggttaggagaaatagatgaaaatagttttcataacatcgatgatcccaactgtgagaggagaaaaaagaactcatttgtgggcctgactaaccttggagccacttgttatgtcaacacatttcttcaagtgtggtttctcaacttggagcttcggcaggcactctacttatgtccaagcacttgtagtgactacatgctgggagacggcatccaagaagaaaaagattatgagcctcaaacaatttgtgagcatctccagtacttgtttgccttgttgcaaaacagtaataggcgatacattgatccatcaggatttgttaaagccttgggcctggacactggacaacagcaggatgctcaagaattttcaaagctctttatgtctctattggaagatactttgtctaaacaaaagaatccagatgtgcgcaatattgttcaacagcagttctgtggagaatatgcctatgtaactgtttgcaaccagtgtggcagagagtctaagcttttgtcaaaattttatgagctggagttaaatatccaaggccacaaacagttaacagattgtatctcggaatttttgaaggaagaaaaattagaaggagacaatcgctatttttgcgagaactgtcaaagcaaacagaatgcaacaagaaagattcgacttcttagccttccttgcactctgaacttgcagctaatgcgttttgtctttgacaggcaaactggacataagaaaaagctgaatacctacattggcttctcagaaattttggatatggagccttatgtggaacataaaggtgggtcctacgtgtatgaactcagcgcagtcctcatacacagaggagtgagtgcttattctggccactacatcgcccacgtgaaagatccacagtctggtgaatggtataagtttaatgatgaagacatagaaaagatggaggggaagaaattacaactagggattgaggaagatctagcagaaccttctaagtctcagacacgtaaacccaagtgtggcaaaggaactcattgctctcgaaatgcatatatgttggtttatagactgcaaactcaagaaaagcccaacactactgttcaagttccagccttttcttcaagagctggtagatcgggataa
Sequence Length
1332
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
120,526 Da
NCBI Official Full Name
Homo sapiens ubiquitin specific peptidase 48, mRNA
NCBI Official Synonym Full Names
ubiquitin specific peptidase 48
NCBI Official Symbol
USP48
NCBI Official Synonym Symbols
USP31; RAP1GA1
NCBI Protein Information
ubiquitin carboxyl-terminal hydrolase 48
UniProt Protein Name
Ubiquitin carboxyl-terminal hydrolase 48
UniProt Gene Name
USP48
UniProt Synonym Gene Names
USP31
UniProt Entry Name
UBP48_HUMAN

NCBI Description

This gene encodes a protein containing domains that associate it with the peptidase family C19, also known as family 2 of ubiquitin carboxyl-terminal hydrolases. Family members function as deubiquitinating enzymes, recognizing and hydrolyzing the peptide bond at the C-terminal glycine of ubiquitin. Enzymes in peptidase family C19 are involved in the processing of poly-ubiquitin precursors as well as that of ubiquitinated proteins. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

USP48: Recognizes and hydrolyzes the peptide bond at the C- terminal Gly of ubiquitin. Involved in the processing of poly- ubiquitin precursors as well as that of ubiquitinated proteins. May be involved in the regulation of NF-kappa-B activation by TNF receptor superfamily via its interactions with RELA and TRAF2. May also play a regulatory role at postsynaptic sites. Belongs to the peptidase C19 family. 7 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.4.19.12; Protease; Ubiquitin conjugating system; Ubiquitin-specific protease

Chromosomal Location of Human Ortholog: 1p36.12

Cellular Component: cytoplasm; mitochondrion; nucleoplasm

Research Articles on USP48

Similar Products

Product Notes

The USP48 usp48 (Catalog #AAA1268944) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccccgc ggctgcagct ggagaaggcg gcctggcgct gggcggagac ggtgcggccc gaggaggtgt cgcaggagca catcgagacc gcttaccgca tctggctgga gccctgcatt cgcggcgtgt gcagacgaaa ctgcaaagga aatccgaatt gcttggttgg tattggtgag catatttggt taggagaaat agatgaaaat agttttcata acatcgatga tcccaactgt gagaggagaa aaaagaactc atttgtgggc ctgactaacc ttggagccac ttgttatgtc aacacatttc ttcaagtgtg gtttctcaac ttggagcttc ggcaggcact ctacttatgt ccaagcactt gtagtgacta catgctggga gacggcatcc aagaagaaaa agattatgag cctcaaacaa tttgtgagca tctccagtac ttgtttgcct tgttgcaaaa cagtaatagg cgatacattg atccatcagg atttgttaaa gccttgggcc tggacactgg acaacagcag gatgctcaag aattttcaaa gctctttatg tctctattgg aagatacttt gtctaaacaa aagaatccag atgtgcgcaa tattgttcaa cagcagttct gtggagaata tgcctatgta actgtttgca accagtgtgg cagagagtct aagcttttgt caaaatttta tgagctggag ttaaatatcc aaggccacaa acagttaaca gattgtatct cggaattttt gaaggaagaa aaattagaag gagacaatcg ctatttttgc gagaactgtc aaagcaaaca gaatgcaaca agaaagattc gacttcttag ccttccttgc actctgaact tgcagctaat gcgttttgtc tttgacaggc aaactggaca taagaaaaag ctgaatacct acattggctt ctcagaaatt ttggatatgg agccttatgt ggaacataaa ggtgggtcct acgtgtatga actcagcgca gtcctcatac acagaggagt gagtgcttat tctggccact acatcgccca cgtgaaagat ccacagtctg gtgaatggta taagtttaat gatgaagaca tagaaaagat ggaggggaag aaattacaac tagggattga ggaagatcta gcagaacctt ctaagtctca gacacgtaaa cccaagtgtg gcaaaggaac tcattgctct cgaaatgcat atatgttggt ttatagactg caaactcaag aaaagcccaa cactactgtt caagttccag ccttttcttc aagagctggt agatcgggat aa. It is sometimes possible for the material contained within the vial of "USP48, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.