Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

USP47 cdna clone

USP47 cDNA Clone

Gene Names
USP47; TRFP
Synonyms
USP47; USP47 cDNA Clone; USP47 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagtccatgtcacagcttgcagttttgtcaagacggtggaagccttcagagatgaagttggatcccttccaggaggttgtattggaaagcagtagtgtggacgaattgcgagagaagcttagtgaaatcagtgggattcctttggatgatattgaatttgctaagggtagaggaacatttccctgtgatatttctgtccttgatattcatcaagatttagactggaatcctaaagtttctaccctgaatgtctggcctctttatatctgtgatgatggtgcggtcatattttatagggataaaacagaagaattaatggaattgacagatgagcaaagaaatgaactgatgaaaaaagaaagcagtcgactccagaagactggacatcgtgtaacatactcacctcgtaaagagaaagcactaaaaatatatctggatggagcaccaaataaagatctgactcaagactga
Sequence Length
474
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
154,697 Da
NCBI Official Full Name
Homo sapiens ubiquitin specific peptidase 47, mRNA
NCBI Official Synonym Full Names
ubiquitin specific peptidase 47
NCBI Official Symbol
USP47
NCBI Official Synonym Symbols
TRFP
NCBI Protein Information
ubiquitin carboxyl-terminal hydrolase 47
UniProt Protein Name
Ubiquitin carboxyl-terminal hydrolase 47
UniProt Gene Name
USP47
UniProt Entry Name
UBP47_HUMAN

Uniprot Description

USP47: Ubiquitin-specific protease that specifically deubiquitinates monoubiquitinated DNA polymerase beta (POLB), stabilizing POLB thereby playing a role in base-excision repair (BER). Acts as a regulator of cell growth and genome integrity. May also indirectly regulates CDC25A expression at a transcriptional level. Belongs to the peptidase C19 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system; Actin-binding; Protease; EC 3.4.19.12; Ubiquitin-specific protease; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 11p15.3

Cellular Component: cytoplasm; nucleus; SCF ubiquitin ligase complex

Molecular Function: protein binding; ubiquitin-specific protease activity

Biological Process: base-excision repair; negative regulation of apoptosis; negative regulation of caspase activity; negative regulation of transcription, DNA-dependent; positive regulation of cell growth; response to DNA damage stimulus; response to drug

Research Articles on USP47

Similar Products

Product Notes

The USP47 usp47 (Catalog #AAA1267659) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagtcca tgtcacagct tgcagttttg tcaagacggt ggaagccttc agagatgaag ttggatccct tccaggaggt tgtattggaa agcagtagtg tggacgaatt gcgagagaag cttagtgaaa tcagtgggat tcctttggat gatattgaat ttgctaaggg tagaggaaca tttccctgtg atatttctgt ccttgatatt catcaagatt tagactggaa tcctaaagtt tctaccctga atgtctggcc tctttatatc tgtgatgatg gtgcggtcat attttatagg gataaaacag aagaattaat ggaattgaca gatgagcaaa gaaatgaact gatgaaaaaa gaaagcagtc gactccagaa gactggacat cgtgtaacat actcacctcg taaagagaaa gcactaaaaa tatatctgga tggagcacca aataaagatc tgactcaaga ctga. It is sometimes possible for the material contained within the vial of "USP47, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.