Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

USP28 cdna clone

USP28 cDNA Clone

Synonyms
USP28; USP28 cDNA Clone; USP28 cdna clone
Ordering
For Research Use Only!
Sequence
atgactgcggagctgcagcaggacgacgcggccggcgcggcagacggccacggctcgagctgccaaatgctgttaaatcaactgagagaaatcacaggcattcaggacccttcctttctccatgaagctctgaaggccagtaatggtgacattactcaggcagtcagccttctcactgatgagagagttaaggagcccagtcaagacactgttgctacagaaccatctgaagtagaggggagtgctgccaacaaggaagtattagcaaaagttatagaccttactcatgataacaaagatgatcttcaggctgccattgctttgagtctactggagtctcccaaaattcaagctgatggaagagatcttaacaggatgcatgaagcaacctctgcagaaactaaacgctcaaagagaaaacgctgtgaagtctggggagaaaaccccaatcccaatgactggaggagagttgatggttggccagttgggctgaaaaatgttggcaatacatgttggtttagtgctgttattcagtctctctttcaattgcctgaatttcgaagacttgttctcagttatagtctgccacaaaatgtacttgaaaattgtcgaagtcatacagaaaagagaaatatcatgtttatgcaagagcttcagtatttgtttgctctaatgatgggatcaaatagaaaatttgtagacccgtctgcagccctggatctattaaagggagcattccgatcatctgaggaacagcagcaagatgtgagtgaattcacacacaagctcctggattggctagaggacgcattccagctagctgttaatgttaacagtcccaggaacaaatctgaaaatccaatggtgcagctgttctatggtactttcctgactgaaggggttcgtgaaggaaaacccttttgtaacaatgagaccttcggccagtatcctcttcaggtaaacggttatcgcaacttagacgagtgtttggaaggggccatggtggagggtgatgttgagcttcttccctccgatcactcggtgaagtatggacaagagcgttggtttacaaagctacctccagtgttgacctttgaactctcaagatttgagtttaatcagtcccttgggcagccagagaaaattcacaataagctggaatttcctcagattatttatatggacaggtacatgtacaggagcaaggagcttattcgaaataagagagagtgtattcgaaagttgaaggaggaaataaaaattctgcagcaaaaattggaaaggtatgtgaaatatggctcaggcccagctcggttcccgctcccggacatgctgaaatatgttattgaatttgctagtacaaaacctgcctcagaaagctgtccacctgaaagtgacacacatatgacattaccactttcttcagtgcactgctcggtttctgaccagacatccaaggaaagtacaagtacagaaagctcttctcaggatgttgaaagtaccttttcttctcctgaagattctttacccaagtctaaaccactgacatcttctcggtcttccatggaaatgccttcacagccagctccacgaacagtcacagatgaggagataaattttgttaagacctgtcttcagagatggaggagtgagattgaacaagatatacaagatttaaagacttgtattgcaagtactactcagactattgaacagatgtactgcgatcctctccttcgtcaggtagaatga
Sequence Length
1752
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
66,243 Da
NCBI Official Full Name
Homo sapiens ubiquitin specific peptidase 28, mRNA
NCBI Official Synonym Full Names
ubiquitin specific peptidase 28
NCBI Official Symbol
USP28
NCBI Protein Information
ubiquitin carboxyl-terminal hydrolase 28
UniProt Protein Name
Ubiquitin carboxyl-terminal hydrolase 28
UniProt Gene Name
USP28
UniProt Synonym Gene Names
KIAA1515
UniProt Entry Name
UBP28_HUMAN

NCBI Description

The ubiquitin-dependent protein degradation pathway is essential for proteolysis of intracellular proteins and peptides. Enzymes that remove ubiquitin from ubiquitin-conjugated peptides, like USP28, affect the fate and degradation of intracellular proteins and are essential for maintenance of cell-free ubiquitin pools (Valero et al., 2001).[supplied by OMIM, Mar 2008]

Uniprot Description

USP28: a peptidase of the C19 family. USP28 and FBXW7 regulate Myc protein stability in response to DNA damage. Two isoforms of the human protein are produced by alternative splicing.

Protein type: Protease; Ubiquitin-specific protease; EC 3.4.19.12

Chromosomal Location of Human Ortholog: 11q23

Cellular Component: cytoplasm; nucleolus; nucleoplasm; nucleus; protein complex

Molecular Function: protein binding; ubiquitin-specific protease activity

Biological Process: cell proliferation; DNA damage checkpoint; DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis; protein deubiquitination; Ras protein signal transduction; regulation of protein stability; response to DNA damage stimulus; response to ionizing radiation

Research Articles on USP28

Similar Products

Product Notes

The USP28 usp28 (Catalog #AAA1267690) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactgcgg agctgcagca ggacgacgcg gccggcgcgg cagacggcca cggctcgagc tgccaaatgc tgttaaatca actgagagaa atcacaggca ttcaggaccc ttcctttctc catgaagctc tgaaggccag taatggtgac attactcagg cagtcagcct tctcactgat gagagagtta aggagcccag tcaagacact gttgctacag aaccatctga agtagagggg agtgctgcca acaaggaagt attagcaaaa gttatagacc ttactcatga taacaaagat gatcttcagg ctgccattgc tttgagtcta ctggagtctc ccaaaattca agctgatgga agagatctta acaggatgca tgaagcaacc tctgcagaaa ctaaacgctc aaagagaaaa cgctgtgaag tctggggaga aaaccccaat cccaatgact ggaggagagt tgatggttgg ccagttgggc tgaaaaatgt tggcaataca tgttggttta gtgctgttat tcagtctctc tttcaattgc ctgaatttcg aagacttgtt ctcagttata gtctgccaca aaatgtactt gaaaattgtc gaagtcatac agaaaagaga aatatcatgt ttatgcaaga gcttcagtat ttgtttgctc taatgatggg atcaaataga aaatttgtag acccgtctgc agccctggat ctattaaagg gagcattccg atcatctgag gaacagcagc aagatgtgag tgaattcaca cacaagctcc tggattggct agaggacgca ttccagctag ctgttaatgt taacagtccc aggaacaaat ctgaaaatcc aatggtgcag ctgttctatg gtactttcct gactgaaggg gttcgtgaag gaaaaccctt ttgtaacaat gagaccttcg gccagtatcc tcttcaggta aacggttatc gcaacttaga cgagtgtttg gaaggggcca tggtggaggg tgatgttgag cttcttccct ccgatcactc ggtgaagtat ggacaagagc gttggtttac aaagctacct ccagtgttga cctttgaact ctcaagattt gagtttaatc agtcccttgg gcagccagag aaaattcaca ataagctgga atttcctcag attatttata tggacaggta catgtacagg agcaaggagc ttattcgaaa taagagagag tgtattcgaa agttgaagga ggaaataaaa attctgcagc aaaaattgga aaggtatgtg aaatatggct caggcccagc tcggttcccg ctcccggaca tgctgaaata tgttattgaa tttgctagta caaaacctgc ctcagaaagc tgtccacctg aaagtgacac acatatgaca ttaccacttt cttcagtgca ctgctcggtt tctgaccaga catccaagga aagtacaagt acagaaagct cttctcagga tgttgaaagt accttttctt ctcctgaaga ttctttaccc aagtctaaac cactgacatc ttctcggtct tccatggaaa tgccttcaca gccagctcca cgaacagtca cagatgagga gataaatttt gttaagacct gtcttcagag atggaggagt gagattgaac aagatataca agatttaaag acttgtattg caagtactac tcagactatt gaacagatgt actgcgatcc tctccttcgt caggtagaat ga. It is sometimes possible for the material contained within the vial of "USP28, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.