Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

USF2 cdna clone

USF2 cDNA Clone

Gene Names
USF2; FIP; bHLHb12
Synonyms
USF2; USF2 cDNA Clone; USF2 cdna clone
Ordering
For Research Use Only!
Sequence
atggacatgctggacccgggtctggatcccgctgcctcggccaccgctgctgccgccgccagccacgacaagggacccgaggcggaggagggcgtcgagctgcaggaaggcggggacggcccaggagcggaggagcagacagcggtggccatcaccagcgtccagcaggcggcgttcggcgaccacaacatccagtaccagttccgcacagagacaaatggaggacaggtgacataccgcgtagtccaggtgactgatggtcagctggacggccagggcgacacagctggcgccgtcagcgtcgtgtccaccgctgccttcgcgggggggcagcaggctgtgacccaggtgggtgtggacggggcagcccagcgcccgggccccgccgctgcctctgtgcccccaggtcctgcagcgcccttcccgctggctgtgatccaaaatcccttcagcaatggtggcagtccggcggccgaggctgtcagcggggaggcacgatttgcctatttcccagcgtccagtgtgggagatactacggctgtgtccgtacagaccacagaccagagcttgcaggctggaggccagttctacgtcatgatgacgccccaggatgtgcttcagacaggaacacagaggacgatcgccccccggacacacccttactctccaaaaattgatggaaccagaacaccccgagatgagaggagaagagcccagcacaacgaagtggagcggaggcggagggacaagatcaacaactggatcgtccagctttcgaaaatcattccagactgtaacgcagacaacagcaagacgggagcgagtaaaggagggatcctgtccaaggcctgcgattacatccgggagttgcgccagaccaaccagcgcatgcaggagaccttcaaagaggccgagcggctgcagatggacaacgagctcctgaggcagcagatcgaggagctgaagaatgagaacgccctgcttcgagcccagctgcagcagcacaacctggagatggtgggcgagggcacccggcagtga
Sequence Length
1041
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,988 Da
NCBI Official Full Name
Homo sapiens upstream transcription factor 2, c-fos interacting, mRNA
NCBI Official Synonym Full Names
upstream transcription factor 2, c-fos interacting
NCBI Official Symbol
USF2
NCBI Official Synonym Symbols
FIP; bHLHb12
NCBI Protein Information
upstream stimulatory factor 2
UniProt Protein Name
Upstream stimulatory factor 2
UniProt Gene Name
USF2
UniProt Synonym Gene Names
BHLHB12; bHLHb12; FIP
UniProt Entry Name
USF2_HUMAN

NCBI Description

This gene encodes a member of the basic helix-loop-helix leucine zipper family of transcription factors. The encoded protein can activate transcription through pyrimidine-rich initiator (Inr) elements and E-box motifs and is involved in regulating multiple cellular processes. [provided by RefSeq, Mar 2016]

Uniprot Description

USF2: Transcription factor that binds to a symmetrical DNA sequence (E-boxes) (5'-CACGTG-3') that is found in a variety of viral and cellular promoters. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription factor; DNA-binding

Chromosomal Location of Human Ortholog: 19q13

Cellular Component: intracellular membrane-bound organelle; nucleoplasm; nucleus

Molecular Function: bHLH transcription factor binding; protein binding; protein heterodimerization activity; protein homodimerization activity; RNA polymerase II transcription factor activity, enhancer binding; sequence-specific DNA binding; transcription factor activity

Biological Process: late viral mRNA transcription; lipid homeostasis; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription from RNA polymerase II promoter by glucose; regulation of transcription from RNA polymerase II promoter by glucose; transcription from RNA polymerase II promoter

Research Articles on USF2

Similar Products

Product Notes

The USF2 usf2 (Catalog #AAA1273605) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacatgc tggacccggg tctggatccc gctgcctcgg ccaccgctgc tgccgccgcc agccacgaca agggacccga ggcggaggag ggcgtcgagc tgcaggaagg cggggacggc ccaggagcgg aggagcagac agcggtggcc atcaccagcg tccagcaggc ggcgttcggc gaccacaaca tccagtacca gttccgcaca gagacaaatg gaggacaggt gacataccgc gtagtccagg tgactgatgg tcagctggac ggccagggcg acacagctgg cgccgtcagc gtcgtgtcca ccgctgcctt cgcggggggg cagcaggctg tgacccaggt gggtgtggac ggggcagccc agcgcccggg ccccgccgct gcctctgtgc ccccaggtcc tgcagcgccc ttcccgctgg ctgtgatcca aaatcccttc agcaatggtg gcagtccggc ggccgaggct gtcagcgggg aggcacgatt tgcctatttc ccagcgtcca gtgtgggaga tactacggct gtgtccgtac agaccacaga ccagagcttg caggctggag gccagttcta cgtcatgatg acgccccagg atgtgcttca gacaggaaca cagaggacga tcgccccccg gacacaccct tactctccaa aaattgatgg aaccagaaca ccccgagatg agaggagaag agcccagcac aacgaagtgg agcggaggcg gagggacaag atcaacaact ggatcgtcca gctttcgaaa atcattccag actgtaacgc agacaacagc aagacgggag cgagtaaagg agggatcctg tccaaggcct gcgattacat ccgggagttg cgccagacca accagcgcat gcaggagacc ttcaaagagg ccgagcggct gcagatggac aacgagctcc tgaggcagca gatcgaggag ctgaagaatg agaacgccct gcttcgagcc cagctgcagc agcacaacct ggagatggtg ggcgagggca cccggcagtg a. It is sometimes possible for the material contained within the vial of "USF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.