Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UQCRH cdna clone

UQCRH cDNA Clone

Gene Names
UQCRH; QCR6; UQCR8
Synonyms
UQCRH; UQCRH cDNA Clone; UQCRH cdna clone
Ordering
For Research Use Only!
Sequence
atgggactggaggacgagcaaaagatgcttaccgaatccggagatcctgaggaggaggaagaggaagaggaggaattagtggatcccctaacaacagtgagagagcaatgcgagcagttggagaaatgtgtaaaggcccgggagcggctagagctctgtgatgagcgtgtatcctctcgatcacatacagaagaggattgcacggaggagctctttgacttcttgcatgcgagggaccattgcgtggcccacaaactctttaacaacttgaaataa
Sequence Length
276
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,739 Da
NCBI Official Full Name
Homo sapiens ubiquinol-cytochrome c reductase hinge protein, mRNA
NCBI Official Synonym Full Names
ubiquinol-cytochrome c reductase hinge protein
NCBI Official Symbol
UQCRH
NCBI Official Synonym Symbols
QCR6; UQCR8
NCBI Protein Information
cytochrome b-c1 complex subunit 6, mitochondrial
UniProt Protein Name
Cytochrome b-c1 complex subunit 6, mitochondrial
UniProt Gene Name
UQCRH
UniProt Entry Name
QCR6_HUMAN

Uniprot Description

UQCRH: This is a component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex), which is part of the mitochondrial respiratory chain. This protein may mediate formation of the complex between cytochromes c and c1. Belongs to the UQCRH/QCR6 family.

Protein type: EC 1.10.2.2; Oxidoreductase; Energy Metabolism - oxidative phosphorylation; Mitochondrial

Chromosomal Location of Human Ortholog: 1p34.1

Cellular Component: mitochondrial inner membrane; mitochondrial respiratory chain; mitochondrion

Molecular Function: protein binding

Biological Process: aerobic respiration; mitochondrial electron transport, ubiquinol to cytochrome c; oxidative phosphorylation

Research Articles on UQCRH

Similar Products

Product Notes

The UQCRH uqcrh (Catalog #AAA1269804) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggactgg aggacgagca aaagatgctt accgaatccg gagatcctga ggaggaggaa gaggaagagg aggaattagt ggatccccta acaacagtga gagagcaatg cgagcagttg gagaaatgtg taaaggcccg ggagcggcta gagctctgtg atgagcgtgt atcctctcga tcacatacag aagaggattg cacggaggag ctctttgact tcttgcatgc gagggaccat tgcgtggccc acaaactctt taacaacttg aaataa. It is sometimes possible for the material contained within the vial of "UQCRH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.