UQCRC1 cdna clone
UQCRC1 cDNA Clone
Gene Names
UQCRC1; QCR1; UQCR1; D3S3191
Synonyms
UQCRC1; UQCRC1 cDNA Clone; UQCRC1 cdna clone
Sequence
atggcggcgtccgtggtctgtcgggccgctaccgccggggcacaagtgctattgcgcgcccgccgctcgccggccctgctgcggacgccagccttgcggagtacggcaaccttcgctcaggcgctccagttcgtgccggagacgcaggttagcctgctggacaacggcctgcgtgtggcctccgagcagtcctctcagcccacttgcacggtgggagtgtggattgatgttggcagccgttttgagactgagaagaataatggggcaggctactttttggagcatctggctttcaagggaacaaagaatcggcctggcagtgccctggagaaggaggtggagagcatgggggcccatcttaatgcctacagcacccgggagcacacagcttactacatcaaggcgctgtccaaggatctgccgaaagctgtggagctcctgggtgacattgtgcagaactgtagtctggaagactcacagattgagaaggaacgtgatgtgatcctgcgggagatgcaggagaatgatgcatctatgcgagatgtggtctttaactacctgcatgccacagcattccagggcacacctctagcccaggctgtggaggggcccagtgagaatgtcaggaagctgtctcgtgcagacttgaccgagtacctcagcacacattacaaggcccctcgaatggtgctggcagcagctggaggagtggagcaccagcaactgttagacctcgcccagaagcacctcggtggcatcccatggacatatgcagaggacgctgtgcccactcttactccatgccgcttcactggcagtgagatccgccaccgtgatgatgctctaccttttgcccacgtggccattgcagtagagggtcctggctgggccagcccggacaatgtggccttgcaagtggccaatgccatcatcggccactatgactgcacttatggtggtggcgtgcacctgtccagcccactggcttcaggtgctgtggccaacaagctatgccagagtttccagaccttcagcatctgctatgcagagacgggcttgctgggtgcacactttgtctgtgaccgaatgaaaatcgatgacatgatgttcgtcctgcaagggcagtggatgcgcctgtgtaccagtgccacggagagtgaggtggcccggggcaaaaacatcctcagaaatgccctggtatctcatctagatggcactactcctgtgtgtgaggacatcggacgcagcctcctgacctatggccgccgcatccccctggctgaatgggaaagccggattgcggaggtggatgccagtgtggtacgtgagatctgctccaagtacatctatgaccagtgcccagcagtggctggatatggccccattgagcagctcccagactacaaccggatccgtagcggcatgttctggctgcgcttctag
Sequence Length
1443
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
52,646 Da
NCBI Official Full Name
Homo sapiens ubiquinol-cytochrome c reductase core protein I, mRNA
NCBI Official Synonym Full Names
ubiquinol-cytochrome c reductase core protein I
NCBI Official Symbol
UQCRC1
NCBI Official Synonym Symbols
QCR1; UQCR1; D3S3191
NCBI Protein Information
cytochrome b-c1 complex subunit 1, mitochondrial
UniProt Protein Name
Cytochrome b-c1 complex subunit 1, mitochondrial
UniProt Gene Name
UQCRC1
UniProt Entry Name
QCR1_HUMAN
Uniprot Description
UQCRC1: This is a component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex), which is part of the mitochondrial respiratory chain. This protein may mediate formation of the complex between cytochromes c and c1. Belongs to the peptidase M16 family. UQCRC1/QCR1 subfamily.
Protein type: Oxidoreductase; Energy Metabolism - oxidative phosphorylation; EC 1.10.2.2; Mitochondrial
Chromosomal Location of Human Ortholog: 3p21.3
Cellular Component: mitochondrial inner membrane; mitochondrial respiratory chain; mitochondrial respiratory chain complex III; mitochondrion
Molecular Function: metalloendopeptidase activity; ubiquinol-cytochrome-c reductase activity; ubiquitin protein ligase binding; zinc ion binding
Biological Process: aerobic respiration; mitochondrial electron transport, ubiquinol to cytochrome c; oxidative phosphorylation; protein processing
Research Articles on UQCRC1
Similar Products
Product Notes
The UQCRC1 uqcrc1 (Catalog #AAA1278403) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgt ccgtggtctg tcgggccgct accgccgggg cacaagtgct attgcgcgcc cgccgctcgc cggccctgct gcggacgcca gccttgcgga gtacggcaac cttcgctcag gcgctccagt tcgtgccgga gacgcaggtt agcctgctgg acaacggcct gcgtgtggcc tccgagcagt cctctcagcc cacttgcacg gtgggagtgt ggattgatgt tggcagccgt tttgagactg agaagaataa tggggcaggc tactttttgg agcatctggc tttcaaggga acaaagaatc ggcctggcag tgccctggag aaggaggtgg agagcatggg ggcccatctt aatgcctaca gcacccggga gcacacagct tactacatca aggcgctgtc caaggatctg ccgaaagctg tggagctcct gggtgacatt gtgcagaact gtagtctgga agactcacag attgagaagg aacgtgatgt gatcctgcgg gagatgcagg agaatgatgc atctatgcga gatgtggtct ttaactacct gcatgccaca gcattccagg gcacacctct agcccaggct gtggaggggc ccagtgagaa tgtcaggaag ctgtctcgtg cagacttgac cgagtacctc agcacacatt acaaggcccc tcgaatggtg ctggcagcag ctggaggagt ggagcaccag caactgttag acctcgccca gaagcacctc ggtggcatcc catggacata tgcagaggac gctgtgccca ctcttactcc atgccgcttc actggcagtg agatccgcca ccgtgatgat gctctacctt ttgcccacgt ggccattgca gtagagggtc ctggctgggc cagcccggac aatgtggcct tgcaagtggc caatgccatc atcggccact atgactgcac ttatggtggt ggcgtgcacc tgtccagccc actggcttca ggtgctgtgg ccaacaagct atgccagagt ttccagacct tcagcatctg ctatgcagag acgggcttgc tgggtgcaca ctttgtctgt gaccgaatga aaatcgatga catgatgttc gtcctgcaag ggcagtggat gcgcctgtgt accagtgcca cggagagtga ggtggcccgg ggcaaaaaca tcctcagaaa tgccctggta tctcatctag atggcactac tcctgtgtgt gaggacatcg gacgcagcct cctgacctat ggccgccgca tccccctggc tgaatgggaa agccggattg cggaggtgga tgccagtgtg gtacgtgaga tctgctccaa gtacatctat gaccagtgcc cagcagtggc tggatatggc cccattgagc agctcccaga ctacaaccgg atccgtagcg gcatgttctg gctgcgcttc tag. It is sometimes possible for the material contained within the vial of "UQCRC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
