Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UPK2 cdna clone

UPK2 cDNA Clone

Gene Names
UPK2; UP2; UPII
Synonyms
UPK2; UPK2 cDNA Clone; UPK2 cdna clone
Ordering
For Research Use Only!
Sequence
ATGGCACCCCTGCTGCCCATCCGGACCTTGCCCTTGATCCTGATTCTGCTGGCTCTGCTGTCCCCAGGGGCTGCAGACTTCAACATCTCAAGCCTCTCTGGTCTGCTGTCCCCGGCACTAACGGAGAGCCTGCTGGTTGCCTTGCCCCCCTGTCACCTCACAGGAGGCAATGCCACACTGATGGTCCGGAGAGCCAATGACAGCAAAGTGGTGACGTCCAGCTTTGTGGTGCCTCCGTGCCGTGGGCGCAGGGAACTGGTGAGTGTGGTGGACAGTGGTGCTGGCTTCACAGTCACTCGGCTCAGTGCATACCAGGTGACAAACCTCGTGCCAGGAACCAAATTCTACATTTCCTACCTAGTGAAGAAGGGGACAGCCACTGAGTCCAGCAGAGAGATCCCAATGTCCACACTCCCTCGAAGGAACATGGAATCCATTGGGCTGGGTATGGCCCGCACAGGGGGCATGGTGGTCATCACGGTGCTGCTCTCTGTCGCCATGTTCCTGCTGGTGCTGGGCTTCATCATTGCCCTGGCACTGGGCTCCCGCAAGTAA
Sequence Length
555
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,438 Da
NCBI Official Full Name
Homo sapiens uroplakin 2, mRNA
NCBI Official Synonym Full Names
uroplakin 2
NCBI Official Symbol
UPK2
NCBI Official Synonym Symbols
UP2; UPII
NCBI Protein Information
uroplakin-2
UniProt Protein Name
Uroplakin-2
Protein Family
UniProt Gene Name
UPK2
UniProt Synonym Gene Names
UP2; UPII
UniProt Entry Name
UPK2_HUMAN

NCBI Description

This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas.[provided by RefSeq, Sep 2009]

Uniprot Description

UPK2: Component of the asymmetric unit membrane (AUM); a highly specialized biomembrane elaborated by terminally differentiated urothelial cells. May play an important role in regulating the assembly of the AUM. Belongs to the uroplakin-2 family.

Protein type: Endoplasmic reticulum; Membrane protein, integral

Chromosomal Location of Human Ortholog: 11q23

Cellular Component: apical plasma membrane; integral to plasma membrane

Molecular Function: protein binding

Biological Process: epithelial cell differentiation; multicellular organismal development

Research Articles on UPK2

Similar Products

Product Notes

The UPK2 upk2 (Catalog #AAA1271701) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGCACCCC TGCTGCCCAT CCGGACCTTG CCCTTGATCC TGATTCTGCT GGCTCTGCTG TCCCCAGGGG CTGCAGACTT CAACATCTCA AGCCTCTCTG GTCTGCTGTC CCCGGCACTA ACGGAGAGCC TGCTGGTTGC CTTGCCCCCC TGTCACCTCA CAGGAGGCAA TGCCACACTG ATGGTCCGGA GAGCCAATGA CAGCAAAGTG GTGACGTCCA GCTTTGTGGT GCCTCCGTGC CGTGGGCGCA GGGAACTGGT GAGTGTGGTG GACAGTGGTG CTGGCTTCAC AGTCACTCGG CTCAGTGCAT ACCAGGTGAC AAACCTCGTG CCAGGAACCA AATTCTACAT TTCCTACCTA GTGAAGAAGG GGACAGCCAC TGAGTCCAGC AGAGAGATCC CAATGTCCAC ACTCCCTCGA AGGAACATGG AATCCATTGG GCTGGGTATG GCCCGCACAG GGGGCATGGT GGTCATCACG GTGCTGCTCT CTGTCGCCAT GTTCCTGCTG GTGCTGGGCT TCATCATTGC CCTGGCACTG GGCTCCCGCA AGTAA. It is sometimes possible for the material contained within the vial of "UPK2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.