UGT3A1 cdna clone
UGT3A1 cDNA Clone
Synonyms
UGT3A1; UGT3A1 cDNA Clone; UGT3A1 cdna clone
Sequence
atgcttcatcagagtggaaagtttttgatcccagatattaaagaggaggaaaaatcataccaagttatcaggtggttttcacctgaagatcatcaaaaaagaattaagaagcattttgatagctacatagaaacagcattggatggcagaaaagaatctgaagcccttgtaaagctaatggaaatatttgggactcaatgtagttatttgctaagcagaaaggatataatggattccttaaagaatgagaactatgatctggtatttgttgaagcatttgatttctgttctttcctgattgctgagaagcttgtgaaaccatttgtggccattcttcccaccacattcggctctttggattttgggctaccaagccccttgtcttatgttccagtattcccttccttgctgactgatcacatggacttctggggccgagtgaagaattttctgatgttctttagtttctccaggagccaatgggacatgcagtctacatttgacaacaccatcaaggagcatttcccagaaggctctaggccagttttgtctcatcttctactgaaagcagagttgtggtttgttaactctgattttgcctttgattttgcccggcccctgcttcccaacactgtttatattggaggcttgatggaaaaacctattaaaccagtaccacaaaatgggcaaccagctctcttcaccacccccagcttattctcctctggagtgtatcctgaaccactgagacggctttga
Sequence Length
759
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
29,186 Da
NCBI Official Full Name
Homo sapiens UDP glycosyltransferase 3 family, polypeptide A1, mRNA
NCBI Official Synonym Full Names
UDP glycosyltransferase family 3 member A1
NCBI Official Symbol
UGT3A1
NCBI Protein Information
UDP-glucuronosyltransferase 3A1
UniProt Protein Name
UDP-glucuronosyltransferase 3A1
Protein Family
UniProt Gene Name
UGT3A1
UniProt Synonym Gene Names
UDPGT 3A1
UniProt Entry Name
UD3A1_HUMAN
Uniprot Description
UGT3A1: UDP-glucuronosyltransferases catalyze phase II biotransformation reactions in which lipophilic substrates are conjugated with glucuronic acid to increase water solubility and enhance excretion. They are of major importance in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds. Belongs to the UDP-glycosyltransferase family.
Protein type: Membrane protein, integral; EC 2.4.1.17; Transferase
Chromosomal Location of Human Ortholog: 5p13.2
Molecular Function: glucuronosyltransferase activity; UDP-glycosyltransferase activity
Biological Process: flavonoid biosynthetic process
Research Articles on UGT3A1
Similar Products
Product Notes
The UGT3A1 ugt3a1 (Catalog #AAA1275770) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcttcatc agagtggaaa gtttttgatc ccagatatta aagaggagga aaaatcatac caagttatca ggtggttttc acctgaagat catcaaaaaa gaattaagaa gcattttgat agctacatag aaacagcatt ggatggcaga aaagaatctg aagcccttgt aaagctaatg gaaatatttg ggactcaatg tagttatttg ctaagcagaa aggatataat ggattcctta aagaatgaga actatgatct ggtatttgtt gaagcatttg atttctgttc tttcctgatt gctgagaagc ttgtgaaacc atttgtggcc attcttccca ccacattcgg ctctttggat tttgggctac caagcccctt gtcttatgtt ccagtattcc cttccttgct gactgatcac atggacttct ggggccgagt gaagaatttt ctgatgttct ttagtttctc caggagccaa tgggacatgc agtctacatt tgacaacacc atcaaggagc atttcccaga aggctctagg ccagttttgt ctcatcttct actgaaagca gagttgtggt ttgttaactc tgattttgcc tttgattttg cccggcccct gcttcccaac actgtttata ttggaggctt gatggaaaaa cctattaaac cagtaccaca aaatgggcaa ccagctctct tcaccacccc cagcttattc tcctctggag tgtatcctga accactgaga cggctttga. It is sometimes possible for the material contained within the vial of "UGT3A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
