UGT2B10 cdna clone

UGT2B10 cDNA Clone

Gene Names

UGT2B10; UDPGT2B10

Synonyms

UGT2B10; UGT2B10 cDNA Clone; UGT2B10 cdna clone

Ordering
Cat. Num. AAA1276858 For Research Use Only!

Sequence

atggctctgaaatggactacagttctgctgatacaactcagtttttactttagctctgggagttgtggaaaggtgctggtatgggccgcagaatacagcctttggatgaatatgaagacaatcctgaaagaacttgttcagagaggtcatgaggtgactgtactggcatcttcagcttccattctttttgatcccaacgactcatccactcttaaacttgaagtttatcctacatctttaactaaaactgaatttgagaatatcatcatgcaattggttaagagattgtcagaaattcaaaaagatacattttggttacctttttcacaagaacaagaaatcctgtgggcaattaatgacataattagaaacttctgtaaagatgtagtttcaaataagaaacttatgaaaaaactacaagagtcaagatttgacatcgtttttgcagatgcttatttaccctgtggtgagctgctggctgagctatttaacataccctttgtgtacagtcacagcttcagtcctggctactcatttgaaaggcacagtggaggatttattttccctccttcctacgtacctgttgttatgtcaaaattaagtgatcaaatgactttcatggagagggtaaaaaatatgctctatgtgctttattttgacttttggttccaaatatttaatatgaagaagtgggatcagttttacagtgaagttttaggaagacccactacattatctgagacaatgaggaaagctgacatatggcttatgcgaaactcctggaattttaaatttcctcatccattcttaccaaatgttgattttgttggaggactccactgcaaacctgccaaacccctacctaaggaaatggaggagtttgtacagagctctggagaaaatggtgttgtggtgttttctctggggtcaatggtcagtaacatgacagaagaaagggccaacgtaattgcaacagcccttgccaagatcccacaaaaggttctttggagatttgatgggaataaaccagatgccttaggtctcaatactcgactgtacaagtggataccccagaatgaccttctaggtcatccaaaaaccagagcttttataactcatggtggagccaatggcatctatgaggcaatctaccatgggatccctatggtgggcattccattgttttttgatcaacctgataatattgctcacatgaaggccaagggagcagctgttagagtggacttcaacacaatgtcgagtacagacctgctgaatgcactgaagacagtaattaatgatccttcatataaagagaatattatgaaattatcaagaattcaacatgatcaaccagtgaagcccctggatcgagcagtcttctggattgaatttgtcatgcgccacaaaggagccaaacatcttcgagttgcagcccacaacctcacctggttccagtaccactctttggatgtgattgggttcctgctggcttgtgtggcaaccgtgctatttatcatcacaaagtgttgtctgttttgtttctggaagtttgctagaaaaggaaagaagggaaaaagggattag

Sequence Length

1587

Vector

Please Inquire

NCBI and Uniprot Product Information

NCBI GI #

109730576

NCBI GeneID

7365

Molecular Weight

50,688 Da

NCBI Official Full Name

Homo sapiens UDP glucuronosyltransferase 2 family, polypeptide B10, mRNA

NCBI Official Synonym Full Names

UDP glucuronosyltransferase family 2 member B10

NCBI Official Symbol

UGT2B10

NCBI Official Synonym Symbols

UDPGT2B10

NCBI Protein Information

UDP-glucuronosyltransferase 2B10

UniProt Protein Name

UDP-glucuronosyltransferase 2B10

Protein Family

UDP-glucuronosyltransferase

UniProt Gene Name

UGT2B10

UniProt Synonym Gene Names

UDPGT 2B10

UniProt Entry Name

UDB10_HUMAN

Uniprot Description

UGT2B10: UDPGT is of major importance in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds. Belongs to the UDP-glycosyltransferase family.

Protein type: Transferase; Cofactor and Vitamin Metabolism - retinol; Xenobiotic Metabolism - drug metabolism - cytochrome P450; Carbohydrate Metabolism - pentose and glucuronate interconversions; Membrane protein, integral; Lipid Metabolism - androgen and estrogen; Cofactor and Vitamin Metabolism - porphyrin and chlorophyll; Xenobiotic Metabolism - metabolism by cytochrome P450; Carbohydrate Metabolism - ascorbate and aldarate; Carbohydrate Metabolism - starch and sucrose; EC 2.4.1.17; Xenobiotic Metabolism - drug metabolism - other enzymes

Chromosomal Location of Human Ortholog: 4q13.2

Cellular Component: intracellular membrane-bound organelle

Molecular Function: glucuronosyltransferase activity

Biological Process: flavonoid biosynthetic process; lipid metabolic process

Research Articles on UGT2B10

1. UGT2B10 variant allele carriers had increased levels of C-oxidation (P = 0.0099)and all pathways should be considered when characterizing the role of nicotine metabolism on smoking behavior and cancer risk.

Similar Products

Product Notes

The UGT2B10 ugt2b10 (Catalog #AAA1276858) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctctga aatggactac agttctgctg atacaactca gtttttactt tagctctggg agttgtggaa aggtgctggt atgggccgca gaatacagcc tttggatgaa tatgaagaca atcctgaaag aacttgttca gagaggtcat gaggtgactg tactggcatc ttcagcttcc attctttttg atcccaacga ctcatccact cttaaacttg aagtttatcc tacatcttta actaaaactg aatttgagaa tatcatcatg caattggtta agagattgtc agaaattcaa aaagatacat tttggttacc tttttcacaa gaacaagaaa tcctgtgggc aattaatgac ataattagaa acttctgtaa agatgtagtt tcaaataaga aacttatgaa aaaactacaa gagtcaagat ttgacatcgt ttttgcagat gcttatttac cctgtggtga gctgctggct gagctattta acataccctt tgtgtacagt cacagcttca gtcctggcta ctcatttgaa aggcacagtg gaggatttat tttccctcct tcctacgtac ctgttgttat gtcaaaatta agtgatcaaa tgactttcat ggagagggta aaaaatatgc tctatgtgct ttattttgac ttttggttcc aaatatttaa tatgaagaag tgggatcagt tttacagtga agttttagga agacccacta cattatctga gacaatgagg aaagctgaca tatggcttat gcgaaactcc tggaatttta aatttcctca tccattctta ccaaatgttg attttgttgg aggactccac tgcaaacctg ccaaacccct acctaaggaa atggaggagt ttgtacagag ctctggagaa aatggtgttg tggtgttttc tctggggtca atggtcagta acatgacaga agaaagggcc aacgtaattg caacagccct tgccaagatc ccacaaaagg ttctttggag atttgatggg aataaaccag atgccttagg tctcaatact cgactgtaca agtggatacc ccagaatgac cttctaggtc atccaaaaac cagagctttt ataactcatg gtggagccaa tggcatctat gaggcaatct accatgggat ccctatggtg ggcattccat tgttttttga tcaacctgat aatattgctc acatgaaggc caagggagca gctgttagag tggacttcaa cacaatgtcg agtacagacc tgctgaatgc actgaagaca gtaattaatg atccttcata taaagagaat attatgaaat tatcaagaat tcaacatgat caaccagtga agcccctgga tcgagcagtc ttctggattg aatttgtcat gcgccacaaa ggagccaaac atcttcgagt tgcagcccac aacctcacct ggttccagta ccactctttg gatgtgattg ggttcctgct ggcttgtgtg gcaaccgtgc tatttatcat cacaaagtgt tgtctgtttt gtttctggaa gtttgctaga aaaggaaaga agggaaaaag ggattag. It is sometimes possible for the material contained within the vial of "UGT2B10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

UGT2B10 cdna clone