Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UGT2A3 cdna clone

UGT2A3 cDNA Clone

Synonyms
UGT2A3; UGT2A3 cDNA Clone; UGT2A3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaggtctgacaagtcagctttggtatttctgctcctgcagctcttctgtgttggctgtggattctgtgggaaagtcctggtgtggccctgtgacatgagccattggcttaatgtcaaggtcattctagaagagctcatagtgagaggccatgaggtaacagtattgactcactcaaagccttcgttaattgactacaggaagccttctgcattgaaatttgaggtggtccatatgccacaggacagaacagaagaaaatgaaatatttgttgacctagctctgaatgtcttgccaggcttatcaacctggcaatcagttataaaattaaatgatttttttgttgaaataagaggaactttaaaaatgatgtgtgagagctttatctacaatcagacacttatgaagaagctacaggaaaccaactacgatgtaatgcttatagaccctgtgattccctgtggagacctgatggctgagttgcttgcagtcccttttgtgctcacacttagaatttctgtaggaggcaatatggagcgaagctgtgggaaacttccagctccactttcctatgtacctgtgcctatgacaggactaacagacagaatgacctttctggaaagagtaaaaaattcaatgctttcagttttgttccacttctggattcaggattacgactatcatttttgggaagagttttatagtaaggcattaggaaggcccactacattatgtgagactgtgggaaaagctgagatatggctaatacgaacatattgggattttgaatttcctcaaccataccaacctaactttgagtttgttggaggattgcactgtaaacctgccaaagctttgcctaaggaaatggaaaattttgtccagagttcaggggaagatggtattgtggtgttttctctggggtcactgtttcaaaatgttacagaagaaaaggctaatatcattgcttcagcccttgcccagatcccacagaaggtgttatggaggtacaaaggaaaaaaaccatccacattaggagccaatactcggctgtatgattggataccccagaatgatcttcttggtcatcccaaaaccaaagcttttatcactcatggtggaatgaatgggatctatgaagctatttaccatggggtccctatggtgggagttcccatatttggtgatcagcttgataacatagctcacatgaaggccaaaggagcagctgtagaaataaacttcaaaactatgacaagcgaagatttactgagggctttgagaacagtcattaccgattcctcttataaagagaatgctatgagattatcaagaattcaccatgatcaacctgtaaagcccctagatcgagcagtcttctggatcgagtttgtcatgcgccacaaaggagccaagcacctgcgatcagctgcccatgacctcacctggttccagcactactctatagatgtgattgggttcctgctgacctgtgtggcaactgctatattcttgttcacaaaatgttttttattttcctgtcaaaaatttaataaaactagaaagatagaaaagagggaatag
Sequence Length
1584
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,254 Da
NCBI Official Full Name
Homo sapiens UDP glucuronosyltransferase 2 family, polypeptide A3, mRNA
NCBI Official Synonym Full Names
UDP glucuronosyltransferase family 2 member A3
NCBI Official Symbol
UGT2A3
NCBI Protein Information
UDP-glucuronosyltransferase 2A3
UniProt Protein Name
UDP-glucuronosyltransferase 2A3
UniProt Gene Name
UGT2A3
UniProt Synonym Gene Names
UDPGT 2A3
UniProt Entry Name
UD2A3_HUMAN

Uniprot Description

UGT2A3: UDP-glucuronosyltransferases catalyze phase II biotransformation reactions in which lipophilic substrates are conjugated with glucuronic acid to increase water solubility and enhance excretion. They are of major importance in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds. Belongs to the UDP-glycosyltransferase family.

Protein type: Membrane protein, integral; Cofactor and Vitamin Metabolism - retinol; Carbohydrate Metabolism - pentose and glucuronate interconversions; Transferase; Carbohydrate Metabolism - starch and sucrose; Xenobiotic Metabolism - drug metabolism - other enzymes; EC 2.4.1.17; Carbohydrate Metabolism - ascorbate and aldarate; Lipid Metabolism - androgen and estrogen; Cofactor and Vitamin Metabolism - porphyrin and chlorophyll; Xenobiotic Metabolism - drug metabolism - cytochrome P450; Xenobiotic Metabolism - metabolism by cytochrome P450

Chromosomal Location of Human Ortholog: 4q13.2

Cellular Component: intracellular membrane-bound organelle

Molecular Function: glucuronosyltransferase activity

Biological Process: flavonoid biosynthetic process

Research Articles on UGT2A3

Similar Products

Product Notes

The UGT2A3 ugt2a3 (Catalog #AAA1276277) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggtctg acaagtcagc tttggtattt ctgctcctgc agctcttctg tgttggctgt ggattctgtg ggaaagtcct ggtgtggccc tgtgacatga gccattggct taatgtcaag gtcattctag aagagctcat agtgagaggc catgaggtaa cagtattgac tcactcaaag ccttcgttaa ttgactacag gaagccttct gcattgaaat ttgaggtggt ccatatgcca caggacagaa cagaagaaaa tgaaatattt gttgacctag ctctgaatgt cttgccaggc ttatcaacct ggcaatcagt tataaaatta aatgattttt ttgttgaaat aagaggaact ttaaaaatga tgtgtgagag ctttatctac aatcagacac ttatgaagaa gctacaggaa accaactacg atgtaatgct tatagaccct gtgattccct gtggagacct gatggctgag ttgcttgcag tcccttttgt gctcacactt agaatttctg taggaggcaa tatggagcga agctgtggga aacttccagc tccactttcc tatgtacctg tgcctatgac aggactaaca gacagaatga cctttctgga aagagtaaaa aattcaatgc tttcagtttt gttccacttc tggattcagg attacgacta tcatttttgg gaagagtttt atagtaaggc attaggaagg cccactacat tatgtgagac tgtgggaaaa gctgagatat ggctaatacg aacatattgg gattttgaat ttcctcaacc ataccaacct aactttgagt ttgttggagg attgcactgt aaacctgcca aagctttgcc taaggaaatg gaaaattttg tccagagttc aggggaagat ggtattgtgg tgttttctct ggggtcactg tttcaaaatg ttacagaaga aaaggctaat atcattgctt cagcccttgc ccagatccca cagaaggtgt tatggaggta caaaggaaaa aaaccatcca cattaggagc caatactcgg ctgtatgatt ggatacccca gaatgatctt cttggtcatc ccaaaaccaa agcttttatc actcatggtg gaatgaatgg gatctatgaa gctatttacc atggggtccc tatggtggga gttcccatat ttggtgatca gcttgataac atagctcaca tgaaggccaa aggagcagct gtagaaataa acttcaaaac tatgacaagc gaagatttac tgagggcttt gagaacagtc attaccgatt cctcttataa agagaatgct atgagattat caagaattca ccatgatcaa cctgtaaagc ccctagatcg agcagtcttc tggatcgagt ttgtcatgcg ccacaaagga gccaagcacc tgcgatcagc tgcccatgac ctcacctggt tccagcacta ctctatagat gtgattgggt tcctgctgac ctgtgtggca actgctatat tcttgttcac aaaatgtttt ttattttcct gtcaaaaatt taataaaact agaaagatag aaaagaggga atag. It is sometimes possible for the material contained within the vial of "UGT2A3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.