UBTD1 cdna clone
UBTD1 cDNA Clone
Synonyms
UBTD1; UBTD1 cDNA Clone; UBTD1 cdna clone
Sequence
atgggcaactgcgtggggagacagcgccgggagaggccggcagccccgggacacccccgcaagcgagcaggacgcaatgagcccctgaagaaagagcggcttaagtggaagagcgactaccccatgactgacgggcagctgcggagcaaacgggatgagttctgggacacagcgcctgccttcgagggccgcaaggagatctgggatgccctcaaggctgccgcctatgctgctgaagccaacgaccacgagctggcccaggccatcctggatggagccagcatcaccctgcctcatggcaccctctgtgaatgctacgatgagctgggcaatcgctaccagctgcccatctactgcctgtcaccgccggtgaacctgctgctggagcacacggaggaggagagcctggagccccccgagcctccacccagcgtgcgccgtgagttcccgctgaaggtgcgcctgtccacgggcaaggacgtgaggctcagcgccagcctgcccgacacagtggggcagctcaagaggcagctgcacgcccaggagggcatcgagccatcgtggcagcggtggttcttctccgggaagctgctcacagaccgcacacggctccaggagaccaagatccagaaagattttgtcatccaggtcatcatcaaccagcccccaccaccccaggactga
Sequence Length
684
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
25,938 Da
NCBI Official Full Name
Homo sapiens ubiquitin domain containing 1, mRNA
NCBI Official Synonym Full Names
ubiquitin domain containing 1
NCBI Official Symbol
UBTD1
NCBI Protein Information
ubiquitin domain-containing protein 1
UniProt Protein Name
Ubiquitin domain-containing protein 1
Protein Family
UniProt Gene Name
UBTD1
UniProt Entry Name
UBTD1_HUMAN
NCBI Description
The degradation of many proteins is carried out by the ubiquitin pathway in which proteins are targeted for degradation by covalent conjugation of the polypeptide ubiquitin. This gene encodes a protein that belongs to the ubiquitin family of proteins. The encoded protein is thought to regulate E2 ubiquitin conjugating enzymes belonging to the UBE2D family. [provided by RefSeq, Mar 2014]
Uniprot Description
UBTD1:
Chromosomal Location of Human Ortholog: 10q24.2
Molecular Function: protein binding
Research Articles on UBTD1
Similar Products
Product Notes
The UBTD1 ubtd1 (Catalog #AAA1278781) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcaact gcgtggggag acagcgccgg gagaggccgg cagccccggg acacccccgc aagcgagcag gacgcaatga gcccctgaag aaagagcggc ttaagtggaa gagcgactac cccatgactg acgggcagct gcggagcaaa cgggatgagt tctgggacac agcgcctgcc ttcgagggcc gcaaggagat ctgggatgcc ctcaaggctg ccgcctatgc tgctgaagcc aacgaccacg agctggccca ggccatcctg gatggagcca gcatcaccct gcctcatggc accctctgtg aatgctacga tgagctgggc aatcgctacc agctgcccat ctactgcctg tcaccgccgg tgaacctgct gctggagcac acggaggagg agagcctgga gccccccgag cctccaccca gcgtgcgccg tgagttcccg ctgaaggtgc gcctgtccac gggcaaggac gtgaggctca gcgccagcct gcccgacaca gtggggcagc tcaagaggca gctgcacgcc caggagggca tcgagccatc gtggcagcgg tggttcttct ccgggaagct gctcacagac cgcacacggc tccaggagac caagatccag aaagattttg tcatccaggt catcatcaac cagcccccac caccccagga ctga. It is sometimes possible for the material contained within the vial of "UBTD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
