UBLCP1 cdna clone

UBLCP1 cDNA Clone

Gene Names

UBLCP1; CPUB1

Synonyms

UBLCP1; UBLCP1 cDNA Clone; UBLCP1 cdna clone

Ordering
Cat. Num. AAA1277480 For Research Use Only!

Sequence

atggctctccctatcattgtaaaatggggtggacaggagtattcagtgaccacactttcagaagatgatactgtgctcgatctcaaacagtttctcaagacccttacaggagttcttccagaacgccaaaagttacttggactcaaagttaaaggcaaacctgcagaaaatgatgttaagcttggagctctcaaactgaaaccaaatactaaaatcatgatgatgggaactcgtgaggagagcttggaagatgtcttaggtccaccccctgacaatgatgatgttgttaatgactttgatattgaagatgaagtagttgaagtagaaaatagggaagaaaacctactgaaaatttctcgcagagtgaaagagtacaaagtggaaattttgaatcctcccagggaagggaaaaagcttttggtgctagatgttgattatacattatttgaccacaggtcttgtgcagagactggggtagaattaatgcggccatatcttcatgaatttctaacatctgcctatgaagattatgacattgttatttggtctgcaacaaatatgaagtggattgaagctaaaatgaaagagctgggagtgagcacaaatgcaaattataagattactttcatgttggatagtgctgctatgataacagtacatactccaaggagaggattaatagacgtaaagcctcttggtgttatatggggaaagttttcggagttttacagcaagaaaaacaccattatgtttgatgacatagggagaaattttctaatgaacccacagaatggactaaagataaggccttttatgaaagcgcacctaaatcgtgataaagacaaagaacttttaaaattaactcagtacctcaaggagatagcaaaattagatgactttttggatctaaatcacaaatattgggaaagatatctctcaaagaagcaaggacagtag

Sequence Length

957

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

34190314

NCBI GeneID

134510

Molecular Weight

36,805 Da

NCBI Official Full Name

Homo sapiens ubiquitin-like domain containing CTD phosphatase 1, mRNA

NCBI Official Synonym Full Names

ubiquitin like domain containing CTD phosphatase 1

NCBI Official Symbol

UBLCP1

NCBI Official Synonym Symbols

CPUB1

NCBI Protein Information

ubiquitin-like domain-containing CTD phosphatase 1

UniProt Protein Name

Ubiquitin-like domain-containing CTD phosphatase 1

Protein Family

Ubiquitin-like domain-containing CTD phosphatase

UniProt Gene Name

UBLCP1

UniProt Entry Name

UBCP1_HUMAN

Uniprot Description

UBLCP1: Dephosphorylates 26S nuclear proteasomes, thereby decreasing their proteolytic activity. The dephosphorylation may prevent assembly of the core and regulatory particles (CP and RP) into mature 26S proteasome.

Protein type: EC 3.1.3.16; Hydrolase

Chromosomal Location of Human Ortholog: 5q33.3

Cellular Component: nucleolus; nucleus

Molecular Function: protein binding; protein serine/threonine phosphatase activity

Biological Process: protein amino acid dephosphorylation

Research Articles on UBLCP1

1. the high-resolution solution structure of the UBL domain of human UBLCP1 and its interaction with Rpn1

Similar Products

Product Notes

The UBLCP1 ublcp1 (Catalog #AAA1277480) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctctcc ctatcattgt aaaatggggt ggacaggagt attcagtgac cacactttca gaagatgata ctgtgctcga tctcaaacag tttctcaaga cccttacagg agttcttcca gaacgccaaa agttacttgg actcaaagtt aaaggcaaac ctgcagaaaa tgatgttaag cttggagctc tcaaactgaa accaaatact aaaatcatga tgatgggaac tcgtgaggag agcttggaag atgtcttagg tccaccccct gacaatgatg atgttgttaa tgactttgat attgaagatg aagtagttga agtagaaaat agggaagaaa acctactgaa aatttctcgc agagtgaaag agtacaaagt ggaaattttg aatcctccca gggaagggaa aaagcttttg gtgctagatg ttgattatac attatttgac cacaggtctt gtgcagagac tggggtagaa ttaatgcggc catatcttca tgaatttcta acatctgcct atgaagatta tgacattgtt atttggtctg caacaaatat gaagtggatt gaagctaaaa tgaaagagct gggagtgagc acaaatgcaa attataagat tactttcatg ttggatagtg ctgctatgat aacagtacat actccaagga gaggattaat agacgtaaag cctcttggtg ttatatgggg aaagttttcg gagttttaca gcaagaaaaa caccattatg tttgatgaca tagggagaaa ttttctaatg aacccacaga atggactaaa gataaggcct tttatgaaag cgcacctaaa tcgtgataaa gacaaagaac ttttaaaatt aactcagtac ctcaaggaga tagcaaaatt agatgacttt ttggatctaa atcacaaata ttgggaaaga tatctctcaa agaagcaagg acagtag. It is sometimes possible for the material contained within the vial of "UBLCP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

UBLCP1 cdna clone