UBE3C cdna clone
UBE3C cDNA Clone
Gene Names
UBE3C; HECTH2
Synonyms
UBE3C; UBE3C cDNA Clone; UBE3C cdna clone
Sequence
atgttcagcttcgaaggcgacttcaagacgcggcccaaggtgtcccttggcggcgcgagcaggaagtattccatccaaagaagtgcatttgatcgctgtgctaccttgtcacagtccgggggcgcttttcccattgctaatggccccaaccttacccttttggtaaggcagcttctgtttttttacaaacaaaatgaagactcaaaacgtttgatatggctgtatcagaacttaattaaacacagctctctgtttgtcaagcagttggatggatctgagagacttacatgcttatttcagataaaaagattgatgagcctctgttgcaggttgctgcaaaactgtaatgatgacagtttgaatgttgcacttccaatgagaatgcttgaagtattttcgtctgagaatacttacttgcctgttttacaagatgctagctatgtggtgtcagtgattgaacaaattttgcactacatgattcacaatgggtattataggtctctatatttgttgattaacagcaagcttccatcaagtattgaatattctgatttatctcgagttcctatagcaaaaattttgctagagaatgttctaaaaccattgcactttacttacaactcctgtccggaaggtgcgaggcaacaagtttttacagccttcacagaggagtttctggcagcaccttttacagatcagatttttcatttcatcattccggcgcttgcagatgcgcagaccgttttcccttacgagccctttctgaatgcactgttgttaatagagagtagatgttcaagaaagagtggtggagcaccctggcttttctatttcgttttaactgttggcgaaaattatttgggggccctctctgaggaagggctgctggtgtatttgcgggtgctgcagaccttcctctctcagttaccagtctctcctgccagcgcgagctgtcacgactcagccagtgactctgaggaggagagtgaagaagccgacaagccctcaagcccggaggatggcagactgtcagtatcatacataacagaggaatgcctgaagaagctggacacaaagcagcagaccaacaccctgctcaacctggtgtggagggactctgcgagcgaggaggtcttcaccaccatggcctccgtctgccacacgctgatggtgcagcaccgcatgatggtacccaaagtcagggtgtacaaatga
Sequence Length
1215
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
45,845 Da
NCBI Official Full Name
Homo sapiens ubiquitin protein ligase E3C, mRNA
NCBI Official Synonym Full Names
ubiquitin protein ligase E3C
NCBI Official Symbol
UBE3C
NCBI Official Synonym Symbols
HECTH2
NCBI Protein Information
ubiquitin-protein ligase E3C
UniProt Protein Name
Ubiquitin-protein ligase E3C
Protein Family
UniProt Gene Name
UBE3C
UniProt Synonym Gene Names
KIAA0010; KIAA10
UniProt Entry Name
UBE3C_HUMAN
Uniprot Description
UBE3C: E3 ubiquitin-protein ligase that accepts ubiquitin from the E2 ubiquitin-conjugating enzyme UBE2D1 in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. Can assemble unanchored poly-ubiquitin chains in either 'Lys-29'- or 'Lys-48'-linked polyubiquitin chains. Has preference for 'Lys-48' linkages. It can target itself for ubiquitination in vitro and may promote its own degradation in vivo. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 6.3.2.-; Ubiquitin ligase; Ligase; EC 6.3.2.19; Ubiquitin conjugating system
Chromosomal Location of Human Ortholog: 7q36.3
Cellular Component: cytoplasm; intracellular; nucleus
Molecular Function: protein binding; ubiquitin-protein ligase activity
Biological Process: protein polyubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process
Research Articles on UBE3C
Similar Products
Product Notes
The UBE3C ube3c (Catalog #AAA1267850) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttcagct tcgaaggcga cttcaagacg cggcccaagg tgtcccttgg cggcgcgagc aggaagtatt ccatccaaag aagtgcattt gatcgctgtg ctaccttgtc acagtccggg ggcgcttttc ccattgctaa tggccccaac cttacccttt tggtaaggca gcttctgttt ttttacaaac aaaatgaaga ctcaaaacgt ttgatatggc tgtatcagaa cttaattaaa cacagctctc tgtttgtcaa gcagttggat ggatctgaga gacttacatg cttatttcag ataaaaagat tgatgagcct ctgttgcagg ttgctgcaaa actgtaatga tgacagtttg aatgttgcac ttccaatgag aatgcttgaa gtattttcgt ctgagaatac ttacttgcct gttttacaag atgctagcta tgtggtgtca gtgattgaac aaattttgca ctacatgatt cacaatgggt attataggtc tctatatttg ttgattaaca gcaagcttcc atcaagtatt gaatattctg atttatctcg agttcctata gcaaaaattt tgctagagaa tgttctaaaa ccattgcact ttacttacaa ctcctgtccg gaaggtgcga ggcaacaagt ttttacagcc ttcacagagg agtttctggc agcacctttt acagatcaga tttttcattt catcattccg gcgcttgcag atgcgcagac cgttttccct tacgagccct ttctgaatgc actgttgtta atagagagta gatgttcaag aaagagtggt ggagcaccct ggcttttcta tttcgtttta actgttggcg aaaattattt gggggccctc tctgaggaag ggctgctggt gtatttgcgg gtgctgcaga ccttcctctc tcagttacca gtctctcctg ccagcgcgag ctgtcacgac tcagccagtg actctgagga ggagagtgaa gaagccgaca agccctcaag cccggaggat ggcagactgt cagtatcata cataacagag gaatgcctga agaagctgga cacaaagcag cagaccaaca ccctgctcaa cctggtgtgg agggactctg cgagcgagga ggtcttcacc accatggcct ccgtctgcca cacgctgatg gtgcagcacc gcatgatggt acccaaagtc agggtgtaca aatga. It is sometimes possible for the material contained within the vial of "UBE3C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
