Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UBE2F cdna clone

UBE2F cDNA Clone

Gene Names
UBE2F; NCE2
Synonyms
UBE2F; UBE2F cDNA Clone; UBE2F cdna clone
Ordering
For Research Use Only!
Sequence
atgctaacgctagcaagtaaactgaagcgtgacgatggtctcaaagggtcccggacggcagccacagcgtccgactcgactcggagggtttctgtgagagacaaattgcttgttaaagaggttgcagaacttgaagctaatttaccttgtacatgtaaagtgcattttcctgatccaaacaagcttcattgttttcagctaacagtaaccccagatgagggttactaccagggtggaaaatttcagtttgaaactgaagttcccgatgcgtacaacatggtgcctcccaaagtgaaatgcctgaccaagatctggcaccccaacatcacagagacaggggaaatatgtctgagtttattgagagaacattcaattgatggcactggctgggctcccacaagaacattaaaggatgtcgtttggggattaaactctttgtttactgatcttttgaattttgatgatccactgaatattgaagctgcagaacatcatttgcgggacaaggaggacttccggaataaagtggatgactacatcaaacgttatgccagatga
Sequence Length
558
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,158 Da
NCBI Official Full Name
Homo sapiens ubiquitin-conjugating enzyme E2F (putative), mRNA
NCBI Official Synonym Full Names
ubiquitin conjugating enzyme E2 F (putative)
NCBI Official Symbol
UBE2F
NCBI Official Synonym Symbols
NCE2
NCBI Protein Information
NEDD8-conjugating enzyme UBE2F
UniProt Protein Name
NEDD8-conjugating enzyme UBE2F
Protein Family
UniProt Gene Name
UBE2F
UniProt Synonym Gene Names
NCE2
UniProt Entry Name
UBE2F_HUMAN

Uniprot Description

UBE2F: Accepts the ubiquitin-like protein NEDD8 from the UBA3- NAE1 E1 complex and catalyzes its covalent attachment to other proteins. The specific interaction with the E3 ubiquitin ligase RBX2, but not RBX1, suggests that the RBX2-UBE2F complex neddylates specific target proteins, such as CUL5. Belongs to the ubiquitin-conjugating enzyme family. UBE2F subfamily. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Ligase; EC 6.3.2.19; Ubiquitin conjugating system; Ubiquitin ligase; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 2q37.3

Cellular Component: cytoplasm; nucleus

Molecular Function: NEDD8 ligase activity; protein binding; ubiquitin protein ligase binding

Biological Process: postreplication repair; protein neddylation

Research Articles on UBE2F

Similar Products

Product Notes

The UBE2F ube2f (Catalog #AAA1277920) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctaacgc tagcaagtaa actgaagcgt gacgatggtc tcaaagggtc ccggacggca gccacagcgt ccgactcgac tcggagggtt tctgtgagag acaaattgct tgttaaagag gttgcagaac ttgaagctaa tttaccttgt acatgtaaag tgcattttcc tgatccaaac aagcttcatt gttttcagct aacagtaacc ccagatgagg gttactacca gggtggaaaa tttcagtttg aaactgaagt tcccgatgcg tacaacatgg tgcctcccaa agtgaaatgc ctgaccaaga tctggcaccc caacatcaca gagacagggg aaatatgtct gagtttattg agagaacatt caattgatgg cactggctgg gctcccacaa gaacattaaa ggatgtcgtt tggggattaa actctttgtt tactgatctt ttgaattttg atgatccact gaatattgaa gctgcagaac atcatttgcg ggacaaggag gacttccgga ataaagtgga tgactacatc aaacgttatg ccagatga. It is sometimes possible for the material contained within the vial of "UBE2F, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.