Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UBE2D4 cdna clone

UBE2D4 cDNA Clone

Gene Names
UBE2D4; HBUCE1
Synonyms
UBE2D4; UBE2D4 cDNA Clone; UBE2D4 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgctaaagcggatccagaaggaattaaccgacttgcagagggatcctcctgcccagtgttctgcaggacctgtcggtgatgacttgttccactggcaggccaccatcatgggcccgaatgacagtccttaccaaggaggtgttttcttcctgaccatccactttcctacagattacccgttcaagcccccaaaggttgctttcacaaccaaaatttatcaccctaatatcaacagcaatggcagcatctgccttgatatcctgcggtctcagtggtctccagcgttgactgtgtcaaaagttctcttgtccatctgctcgctgctctgcgaccccaaccccgatgaccccctggtgccagagatagcacacacctacaaggccgacagagagaagtacaacagactagcaagagagtggacacaaaaatatgctatgtaa
Sequence Length
444
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,649 Da
NCBI Official Full Name
Homo sapiens ubiquitin-conjugating enzyme E2D 4 (putative), mRNA
NCBI Official Synonym Full Names
ubiquitin conjugating enzyme E2 D4 (putative)
NCBI Official Symbol
UBE2D4
NCBI Official Synonym Symbols
HBUCE1
NCBI Protein Information
ubiquitin-conjugating enzyme E2 D4
UniProt Protein Name
Ubiquitin-conjugating enzyme E2 D4
UniProt Gene Name
UBE2D4
UniProt Synonym Gene Names
UBCH5D
UniProt Entry Name
UB2D4_HUMAN

Uniprot Description

UBE2D4: Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. In vitro able to promote polyubiquitination using all 7 ubiquitin Lys residues, but may prefer 'Lys-11' and 'Lys-48'-linked polyubiquitination. Belongs to the ubiquitin-conjugating enzyme family.

Protein type: EC 6.3.2.19; Ubiquitin conjugating system; Ubiquitin ligase; Ligase

Chromosomal Location of Human Ortholog: 7p13

Molecular Function: protein binding; ubiquitin-protein ligase activity

Biological Process: protein ubiquitination

Similar Products

Product Notes

The UBE2D4 ube2d4 (Catalog #AAA1275192) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgctaa agcggatcca gaaggaatta accgacttgc agagggatcc tcctgcccag tgttctgcag gacctgtcgg tgatgacttg ttccactggc aggccaccat catgggcccg aatgacagtc cttaccaagg aggtgttttc ttcctgacca tccactttcc tacagattac ccgttcaagc ccccaaaggt tgctttcaca accaaaattt atcaccctaa tatcaacagc aatggcagca tctgccttga tatcctgcgg tctcagtggt ctccagcgtt gactgtgtca aaagttctct tgtccatctg ctcgctgctc tgcgacccca accccgatga ccccctggtg ccagagatag cacacaccta caaggccgac agagagaagt acaacagact agcaagagag tggacacaaa aatatgctat gtaa. It is sometimes possible for the material contained within the vial of "UBE2D4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.