Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UBAC1 cdna clone

UBAC1 cDNA Clone

Gene Names
UBAC1; KPC2; GBDR1; UBADC1
Synonyms
UBAC1; UBAC1 cDNA Clone; UBAC1 cdna clone
Ordering
For Research Use Only!
Sequence
atgttcgtgcaggaggagaagatcttcgcgggcaaggtgctgcggctgcacatctgcgcgtccgacggcgccgagtggctggaggaggccaccgaggacacctcggtggagaagctcaaggagcgctgcctcaagcactgtgctcatgggagcttagaagatcccaaaagtataacccatcataaattaatccacgctgcctcagagagggtgctgagtgatgccaggaccatcctggaagagaacatccaggaccaagatgtcctattattgataaaaaagcgtgctccatcaccacttcccaagatggctgatgtctcagcagaagaaaagaaaaaacaagaccagaaagctccagataaagaggccatactgcgggccaccgccaacctgccctcctacaacatggaccgggccgcggtccagaccaacatgagagacttccagacagaactccggaagatactggtgtctctcatcgaggtggcgcagaagctgttagcgctgaacccagatgcggtggaattgtttaagaaggcgaatgcaatgctggacgaggacgaggatgagcgtgtggacgaggctgccctgcggcagctcacggagatgggctttccggagaacagagccaccaaggcccttcagctgaaccacatgtcggtgcctcaggccatggagtggctaattgaacacgcagaagacccgaccatagacacgcctcttcctggccaagctcccccagaggccgagggggccacagcagctgcctccgaggctgccgcgggagccagcgccaccgatgaggaggccagagatgagctgacggaaatcttcaagaagatccggaggaaaagggagtttcgggctgatgctcgggccgtcatttccctgatggagatggggttcgacgagaaagaggtgatagatgccctcagagtgaacaacaaccagcagaatgccgcgtgcgagtggctgctgggggaccggaagccctctccggaggagctggacaagggcatcgaccccgacagtcctctctttcaggccatcctggataacccggtggtgcagctgggcctgaccaacccgaaaacattgctagcatttgaagacatgctggagaacccactgaacagcacccagtggatgaatgatccagaaacggggcctgtcatgctgcagatctctagaatcttccagacactaaatcgcacgtag
Sequence Length
1218
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,338 Da
NCBI Official Full Name
Homo sapiens UBA domain containing 1, mRNA
NCBI Official Synonym Full Names
UBA domain containing 1
NCBI Official Symbol
UBAC1
NCBI Official Synonym Symbols
KPC2; GBDR1; UBADC1
NCBI Protein Information
ubiquitin-associated domain-containing protein 1
UniProt Protein Name
Ubiquitin-associated domain-containing protein 1
UniProt Gene Name
UBAC1
UniProt Synonym Gene Names
GBDR1; KPC2; UBADC1; UBA domain-containing protein 1
UniProt Entry Name
UBAC1_HUMAN

Uniprot Description

UBAC1: Non-catalytic subunit of the KPC complex that acts as E3 ubiquitin-protein ligase. Required for poly-ubiquitination and proteasome-mediated degradation of CDKN1B during G1 phase of the cell cycle.

Chromosomal Location of Human Ortholog: 9q34.3

Cellular Component: cytoplasm; Golgi apparatus; plasma membrane

Molecular Function: protein binding

Research Articles on UBAC1

Similar Products

Product Notes

The UBAC1 ubac1 (Catalog #AAA1270238) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttcgtgc aggaggagaa gatcttcgcg ggcaaggtgc tgcggctgca catctgcgcg tccgacggcg ccgagtggct ggaggaggcc accgaggaca cctcggtgga gaagctcaag gagcgctgcc tcaagcactg tgctcatggg agcttagaag atcccaaaag tataacccat cataaattaa tccacgctgc ctcagagagg gtgctgagtg atgccaggac catcctggaa gagaacatcc aggaccaaga tgtcctatta ttgataaaaa agcgtgctcc atcaccactt cccaagatgg ctgatgtctc agcagaagaa aagaaaaaac aagaccagaa agctccagat aaagaggcca tactgcgggc caccgccaac ctgccctcct acaacatgga ccgggccgcg gtccagacca acatgagaga cttccagaca gaactccgga agatactggt gtctctcatc gaggtggcgc agaagctgtt agcgctgaac ccagatgcgg tggaattgtt taagaaggcg aatgcaatgc tggacgagga cgaggatgag cgtgtggacg aggctgccct gcggcagctc acggagatgg gctttccgga gaacagagcc accaaggccc ttcagctgaa ccacatgtcg gtgcctcagg ccatggagtg gctaattgaa cacgcagaag acccgaccat agacacgcct cttcctggcc aagctccccc agaggccgag ggggccacag cagctgcctc cgaggctgcc gcgggagcca gcgccaccga tgaggaggcc agagatgagc tgacggaaat cttcaagaag atccggagga aaagggagtt tcgggctgat gctcgggccg tcatttccct gatggagatg gggttcgacg agaaagaggt gatagatgcc ctcagagtga acaacaacca gcagaatgcc gcgtgcgagt ggctgctggg ggaccggaag ccctctccgg aggagctgga caagggcatc gaccccgaca gtcctctctt tcaggccatc ctggataacc cggtggtgca gctgggcctg accaacccga aaacattgct agcatttgaa gacatgctgg agaacccact gaacagcacc cagtggatga atgatccaga aacggggcct gtcatgctgc agatctctag aatcttccag acactaaatc gcacgtag. It is sometimes possible for the material contained within the vial of "UBAC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.