Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UBA6 cdna clone

UBA6 cDNA Clone

Gene Names
UBA6; E1-L2; MOP-4; UBE1L2
Synonyms
UBA6; UBA6 cDNA Clone; UBA6 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaggatccgagcctgtggccgcccatcagggggaagaggcgtcctgttcttcctgggggactggcagcacaaataaaaatttgcccattatgtcaacagcatctgtggaaatcgatgatgcattgtatagtcgacagaggtacgttcttggagacacagcaatgcagaagatggccaagtcccatgttttcttaagtgggatgggtggtcttggtttggaaattgcaaagaatcttgttcttgcagggattaaggcagttacaattcatgatacagaaaaatgccaagcatgggatctaggaaccaacttctttctcagtgaagatgatgttgttaataagagaaacagggctgaagctgtacttaaacatattgcagaactaaatccatacgttcatgtcacatcatcttctgttcctttcaatgagaccacagatctctcctttttagataaataccagtgtgtagtattgactgagatgaaacttccattgcagaagaagatcaatgacttttgccgttctcagtgccctccaattaagtttatcagtgcagatgtacatggaatttggtcaaggttattttgtgatttcggtgatgaatttgaagttttagatacaacaggagaagaaccaaaagaaattttcatttcaaacataacgcaagcaaatcctggcattgttacttgccttgaaaatcatcctcacaaactggagacaggacaattcctaacatttcgagaaattaatggaatgacaggtttaaatggatctatacaacaaataacggtgatatcgccattttcttttagtattggtgacaccacagaactggaaccatatttacatggaggcatagctgtccaagttaagactcctaaaacagttttttttgaatcactggagaggcagttaaaacatccaaagtgccttattgtggattttagcaaccctgaggcacctttagagattcacacagctatgcttgccttggaccagtttcaggagaaatacagtcgcaagccaaatgttggatgccaacaagattcagaagaactgttgaaactagcaacatctataagtgaaaccttggaagagaaggtgactattgaaatttatggctgtccgaatatttgtttgttaatacataagtgttctgtatattag
Sequence Length
1170
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,693 Da
NCBI Official Full Name
Homo sapiens ubiquitin-like modifier activating enzyme 6, mRNA
NCBI Official Synonym Full Names
ubiquitin like modifier activating enzyme 6
NCBI Official Symbol
UBA6
NCBI Official Synonym Symbols
E1-L2; MOP-4; UBE1L2
NCBI Protein Information
ubiquitin-like modifier-activating enzyme 6
UniProt Protein Name
Ubiquitin-like modifier-activating enzyme 6
UniProt Gene Name
UBA6
UniProt Synonym Gene Names
MOP4; UBE1L2; Ubiquitin-activating enzyme 6; MOP-4; E1-L2
UniProt Entry Name
UBA6_HUMAN

NCBI Description

Modification of proteins with ubiquitin (UBB; MIM 191339) or ubiquitin-like proteins controls many signaling networks and requires a ubiquitin-activating enzyme (E1), a ubiquitin conjugating enzyme (E2), and a ubiquitin protein ligase (E3). UBE1L2 is an E1 enzyme that initiates the activation and conjugation of ubiquitin-like proteins (Jin et al., 2007 [PubMed 17597759]).[supplied by OMIM, Mar 2008]

Uniprot Description

UBE1L2: Activates ubiquitin by first adenylating its C-terminal glycine residue with ATP, and thereafter linking this residue to the side chain of a cysteine residue in E1, yielding an ubiquitin- E1 thioester and free AMP. Specific for ubiquitin, does not activate ubiquitin-like peptides. Differs from UBE1 in its specificity for substrate E2 charging. Does not charge cell cycle E2s, such as CDC34. Essential for embryonic development. Required for UBD/FAT10 conjugation. Isoform 2 may play a key role in ubiquitin system and may influence spermatogenesis and male fertility. Belongs to the ubiquitin-activating E1 family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin ligase; Ubiquitin conjugating system; EC 6.3.2.19

Chromosomal Location of Human Ortholog: 4q13.2

Cellular Component: cytoplasm; cytosol

Molecular Function: FAT10 activating enzyme activity; protein binding

Biological Process: protein ubiquitination; ubiquitin-dependent protein catabolic process

Research Articles on UBA6

Similar Products

Product Notes

The UBA6 uba6 (Catalog #AAA1267591) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaggat ccgagcctgt ggccgcccat cagggggaag aggcgtcctg ttcttcctgg gggactggca gcacaaataa aaatttgccc attatgtcaa cagcatctgt ggaaatcgat gatgcattgt atagtcgaca gaggtacgtt cttggagaca cagcaatgca gaagatggcc aagtcccatg ttttcttaag tgggatgggt ggtcttggtt tggaaattgc aaagaatctt gttcttgcag ggattaaggc agttacaatt catgatacag aaaaatgcca agcatgggat ctaggaacca acttctttct cagtgaagat gatgttgtta ataagagaaa cagggctgaa gctgtactta aacatattgc agaactaaat ccatacgttc atgtcacatc atcttctgtt cctttcaatg agaccacaga tctctccttt ttagataaat accagtgtgt agtattgact gagatgaaac ttccattgca gaagaagatc aatgactttt gccgttctca gtgccctcca attaagttta tcagtgcaga tgtacatgga atttggtcaa ggttattttg tgatttcggt gatgaatttg aagttttaga tacaacagga gaagaaccaa aagaaatttt catttcaaac ataacgcaag caaatcctgg cattgttact tgccttgaaa atcatcctca caaactggag acaggacaat tcctaacatt tcgagaaatt aatggaatga caggtttaaa tggatctata caacaaataa cggtgatatc gccattttct tttagtattg gtgacaccac agaactggaa ccatatttac atggaggcat agctgtccaa gttaagactc ctaaaacagt tttttttgaa tcactggaga ggcagttaaa acatccaaag tgccttattg tggattttag caaccctgag gcacctttag agattcacac agctatgctt gccttggacc agtttcagga gaaatacagt cgcaagccaa atgttggatg ccaacaagat tcagaagaac tgttgaaact agcaacatct ataagtgaaa ccttggaaga gaaggtgact attgaaattt atggctgtcc gaatatttgt ttgttaatac ataagtgttc tgtatattag. It is sometimes possible for the material contained within the vial of "UBA6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.