Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TXNDC3 cdna clone

TXNDC3 cDNA Clone

Gene Names
NME8; CILD6; SPTRX2; TXNDC3; NM23-H8; sptrx-2; HEL-S-99
Synonyms
TXNDC3; TXNDC3 cDNA Clone; TXNDC3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcaagcaaaaaacgagaagtccagttacagacagtcatcaataatcaaagcctgtgggatgagatgttgcagaacaaaggcttaacagtgattgatgtttaccaagcctggtgtggaccttgcagagcaatgcaacctttattcagaaaattgaaaaatgaactgaacgaagacgaaattctgcattttgctgtcgcagaagctgacaacattgtgactttgcagccatttagagataaatgtgaacctgtttttctctttagtgttaatggcaaaattatcgaaaagattcagggtgcaaatgcaccgcttgttaataaaaaagttattaatttgatcgatgaggagagaaaaattgcagcaggtgaaatggctcgacctcagtatcctgaaattccattagtagactcagattcagaagttagtgaagaatcaccatgtgaaagtgttcaggaattatacagtattgctattatcaaaccggatgctgtgattagtaaaaaagttctagaaattaaaagaaaaattaccaaagctggatttattatagaagcagagcataagacagtgctcactgaagaacaagttgtcaacttctatagtcgaatagcagaccagcgtgacttcgaagagtttgtctcttttatgacaagtggcttaagctatattctagttgtatctcaaggaagtaaacacaatcctccctctgaagaaaccgaaccacagactgacaccgaacctaacgaacgatctgaggatcaacctgaggtcgaagcccaggttacacctggaatgatgaagaacaaacaagacagtttacaagaatatctggaaagacaacatttagctcagctctgtgacattgaagaggatgcagctaatgttgctaagttcatggatgctttcttccccgattttaaaaaaatgaaaagcatgaaattagaaaagacattggcattacttcgaccaaatctctttcatgaaaggaaagatgatgttttgcgtattattaaagatgaagacttcaaaatactggagcaaagacaagtagtattatcggaaaaagaagcacaagcactgtgcaaggaatatgaaaatgaagactattttaataaacttatagaaaacatgaccagtggtccatctctagcccttgttttattgagagacaatggcttgcaatactggaaacaattactgggaccaagaactgttgaagaagccattgaatattttccagagagtttatgtgcacagtttgcgatggacagtttgccggtcaaccagttgtatggcagcgattcattagaaaccgctgaaagggaaatacagcatttctttcctcttcaaagcactttaggcttgattaaacctcatgcaacaagtgaacaaagagagcagatcctgaagatagttaaggaggctggatttgatctgacacaggtgaagaaaatgttcctaactcctgagcaaactgagaaaatttatccaaaagtaacaggaaaagacttttataaagatttattggaaatgttatctgtgggtccatctatggtcatgattctgaccaagtggaatgctgttgcagaatggagacgattgatgggcccaacagacccagaagaagcaaaattactttcccctgactccatccgagcccagtttggaataagtaaattgaaaaacattgtccatggagcatctaacgcctatgaagcaaaagaggttgttaatagactctttgaggatcctgaggaaaactaa
Sequence Length
1767
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
67,270 Da
NCBI Official Full Name
Homo sapiens thioredoxin domain containing 3 (spermatozoa), mRNA
NCBI Official Synonym Full Names
NME/NM23 family member 8
NCBI Official Symbol
NME8
NCBI Official Synonym Symbols
CILD6; SPTRX2; TXNDC3; NM23-H8; sptrx-2; HEL-S-99
NCBI Protein Information
thioredoxin domain-containing protein 3
UniProt Protein Name
Thioredoxin domain-containing protein 3
UniProt Gene Name
NME8
UniProt Synonym Gene Names
SPTRX2; TXNDC3; Sptrx-2
UniProt Entry Name
TXND3_HUMAN

NCBI Description

This gene encodes a protein with an N-terminal thioredoxin domain and three C-terminal nucleoside diphosphate kinase (NDK) domains, but the NDK domains are thought to be catalytically inactive. The sea urchin ortholog of this gene encodes a component of sperm outer dynein arms, and the protein is implicated in ciliary function. Mutations in this gene are implicated in primary ciliary dyskinesia type 6.[provided by RefSeq, Nov 2009]

Uniprot Description

TXNDC3: Probably required during the final stages of sperm tail maturation in the testis and/or epididymis, where extensive disulfide bonding of fibrous sheath (FS) proteins occurs. May be involved in the reduction of disulfide bonds within the sperm FS components. In vitro, it has neither NDP kinase nor reducing activity on disulfide bonds. Defects in NME8 are the cause of primary ciliary dyskinesia type 6 (CILD6). CILD is an autosomal recessive disorder characterized by axonemal abnormalities of motile cilia. Respiratory infections leading to chronic inflammation and bronchiectasis are recurrent, due to defects in the respiratory cilia; reduced fertility is often observed in male patients due to abnormalities of sperm tails. Half of the patients exhibit situs inversus, due to dysfunction of monocilia at the embryonic node and randomization of left-right body asymmetry. Primary ciliary dyskinesia associated with situs inversus is referred to as Kartagener syndrome.

Protein type: Oxidoreductase; Kinase, nucleoside diphosphate; Other group; NDK family

Chromosomal Location of Human Ortholog: 7p14.1

Molecular Function: microtubule binding; nucleoside diphosphate kinase activity

Biological Process: cilium biogenesis

Disease: Ciliary Dyskinesia, Primary, 6

Research Articles on TXNDC3

Similar Products

Product Notes

The TXNDC3 nme8 (Catalog #AAA1274458) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaagca aaaaacgaga agtccagtta cagacagtca tcaataatca aagcctgtgg gatgagatgt tgcagaacaa aggcttaaca gtgattgatg tttaccaagc ctggtgtgga ccttgcagag caatgcaacc tttattcaga aaattgaaaa atgaactgaa cgaagacgaa attctgcatt ttgctgtcgc agaagctgac aacattgtga ctttgcagcc atttagagat aaatgtgaac ctgtttttct ctttagtgtt aatggcaaaa ttatcgaaaa gattcagggt gcaaatgcac cgcttgttaa taaaaaagtt attaatttga tcgatgagga gagaaaaatt gcagcaggtg aaatggctcg acctcagtat cctgaaattc cattagtaga ctcagattca gaagttagtg aagaatcacc atgtgaaagt gttcaggaat tatacagtat tgctattatc aaaccggatg ctgtgattag taaaaaagtt ctagaaatta aaagaaaaat taccaaagct ggatttatta tagaagcaga gcataagaca gtgctcactg aagaacaagt tgtcaacttc tatagtcgaa tagcagacca gcgtgacttc gaagagtttg tctcttttat gacaagtggc ttaagctata ttctagttgt atctcaagga agtaaacaca atcctccctc tgaagaaacc gaaccacaga ctgacaccga acctaacgaa cgatctgagg atcaacctga ggtcgaagcc caggttacac ctggaatgat gaagaacaaa caagacagtt tacaagaata tctggaaaga caacatttag ctcagctctg tgacattgaa gaggatgcag ctaatgttgc taagttcatg gatgctttct tccccgattt taaaaaaatg aaaagcatga aattagaaaa gacattggca ttacttcgac caaatctctt tcatgaaagg aaagatgatg ttttgcgtat tattaaagat gaagacttca aaatactgga gcaaagacaa gtagtattat cggaaaaaga agcacaagca ctgtgcaagg aatatgaaaa tgaagactat tttaataaac ttatagaaaa catgaccagt ggtccatctc tagcccttgt tttattgaga gacaatggct tgcaatactg gaaacaatta ctgggaccaa gaactgttga agaagccatt gaatattttc cagagagttt atgtgcacag tttgcgatgg acagtttgcc ggtcaaccag ttgtatggca gcgattcatt agaaaccgct gaaagggaaa tacagcattt ctttcctctt caaagcactt taggcttgat taaacctcat gcaacaagtg aacaaagaga gcagatcctg aagatagtta aggaggctgg atttgatctg acacaggtga agaaaatgtt cctaactcct gagcaaactg agaaaattta tccaaaagta acaggaaaag acttttataa agatttattg gaaatgttat ctgtgggtcc atctatggtc atgattctga ccaagtggaa tgctgttgca gaatggagac gattgatggg cccaacagac ccagaagaag caaaattact ttcccctgac tccatccgag cccagtttgg aataagtaaa ttgaaaaaca ttgtccatgg agcatctaac gcctatgaag caaaagaggt tgttaataga ctctttgagg atcctgagga aaactaa. It is sometimes possible for the material contained within the vial of "TXNDC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.