Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TWSG1 cdna clone

TWSG1 cDNA Clone

Gene Names
TWSG1; TSG
Synonyms
TWSG1; TWSG1 cDNA Clone; TWSG1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagttacactatgttgctgtgcttactctagccatcctgatgttcctgacatggcttccagaatcactgagctgtaacaaagcactctgtgctagtgatgtgagcaaatgcctcattcaggagctctgccagtgccggccgggagaaggcaattgctcctgctgtaaggagtgcatgctgtgtcttggggccctttgggacgagtgctgtgactgtgttggtatgtgtaatcctcgaaattatagtgacacacctccaacttcaaagagcacagtggaggagctgcatgaaccgatcccttctctcttccgggcactcacagaaggagatactcagttgaattggaacatcgtttctttccctgttgcagaagaactttcacatcatgagaatctggtttcatttttagaaactgtgaaccagccacaccaccagaatgtgtctgtccccagcaataatgttcacgcgccttattccagtgacaaagaacacatgtgtactgtggtttattttgatgactgcatgtccatacatcagtgtaaaatatcctgtgagtccatgggagcatccaaatatcgctggtttcataatgcctgctgcgagtgcattggtccagaatgtattgactatggtagtaaaactgtcaaatgtatgaactgcatgttttaa
Sequence Length
672
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
8,284 Da
NCBI Official Full Name
Homo sapiens twisted gastrulation homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
twisted gastrulation BMP signaling modulator 1
NCBI Official Symbol
TWSG1
NCBI Official Synonym Symbols
TSG
NCBI Protein Information
twisted gastrulation protein homolog 1
UniProt Protein Name
Twisted gastrulation protein homolog 1
UniProt Gene Name
TWSG1
UniProt Synonym Gene Names
TSG
UniProt Entry Name
TWSG1_HUMAN

Uniprot Description

TWSG1: May be involved in dorsoventral axis formation. Seems to antagonize BMP signaling by forming ternary complexes with CHRD and BMPs, thereby preventing BMPs from binding to their receptors. In addition to the anti-BMP function, also has pro-BMP activity, partly mediated by cleavage and degradation of CHRD, which releases BMPs from ternary complexes. May be an important modulator of BMP-regulated cartilage development and chondrocyte differentiation. May play a role in thymocyte development. Belongs to the twisted gastrulation protein family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 18p11.3

Molecular Function: protein binding

Research Articles on TWSG1

Similar Products

Product Notes

The TWSG1 twsg1 (Catalog #AAA1278690) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagttac actatgttgc tgtgcttact ctagccatcc tgatgttcct gacatggctt ccagaatcac tgagctgtaa caaagcactc tgtgctagtg atgtgagcaa atgcctcatt caggagctct gccagtgccg gccgggagaa ggcaattgct cctgctgtaa ggagtgcatg ctgtgtcttg gggccctttg ggacgagtgc tgtgactgtg ttggtatgtg taatcctcga aattatagtg acacacctcc aacttcaaag agcacagtgg aggagctgca tgaaccgatc ccttctctct tccgggcact cacagaagga gatactcagt tgaattggaa catcgtttct ttccctgttg cagaagaact ttcacatcat gagaatctgg tttcattttt agaaactgtg aaccagccac accaccagaa tgtgtctgtc cccagcaata atgttcacgc gccttattcc agtgacaaag aacacatgtg tactgtggtt tattttgatg actgcatgtc catacatcag tgtaaaatat cctgtgagtc catgggagca tccaaatatc gctggtttca taatgcctgc tgcgagtgca ttggtccaga atgtattgac tatggtagta aaactgtcaa atgtatgaac tgcatgtttt aa. It is sometimes possible for the material contained within the vial of "TWSG1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.