Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TUBB6 cdna clone

TUBB6 cDNA Clone

Gene Names
TUBB6; TUBB-5; HsT1601
Synonyms
TUBB6; TUBB6 cDNA Clone; TUBB6 cdna clone
Ordering
For Research Use Only!
Sequence
atgagggagatcgtgcacatccaggcgggccagtgcgggaaccagatcggcaccaagttttgggaagtgatcagcgatgagcacggcatcgacccggccggaggctacgtgggagactcggcgctgcagctggagagaatcaacgtctactacaatgagtcatcgtctcagaaatatgtgcccagggccgccctggtggacttagagccaggcaccatggacagcgtgcggtctgggccttttgggcagcttttccggcctgacaacttcatctttggccagacgggtgcagggaacaactgggcgaaagggcactacacggagggcgcggagctggtggacgcagtgctggacgtggtgcggaaggagtgcgagcactgcgactgcctgcagggcttccagctcacgcactcgctgggcggcggcacgggctcaggcatgggcacgctgctcatcagcaagatccgtgaggagttcccggaccgcatcatgaacaccttcagcgtcatgccctcgcccaaggtgtcggacacggtggtggagccctacaatgccacactgtcggtgcaccagctggtggagaatacagacgagacctactgcatcgacaacgaggcgctctatgacatctgcttccgcactctgaagctgacaacgcccacctacggggacctcaaccacctggtgtccgccaccatgagtggggtcaccacctcgctgcgcttcccgggccagctcaatgctgacctgcgcaagctggcggtgaacatggtgcccttcccgcgcctgcacttcttcatgcctggcttcgcgccgctcaccagccgcggcagccagcagtaccgggccctgaccgtgcccgagctcacccagcagatgttcgacgccaggaacatgatggccgcctgcgatccgcgccatggccgctacctgaccgtggccaccgtgttccgcgggcccatgtccatgaaggaggtggacgagcagatgctggccatccagagtaagaacagcagctacttcgtggagtggattcccaacaacgtgaaggtggccgtgtgcgacatcccgccccgcggcctgaagatggcctccaccttcatcggcaacagcacggccatccaggagctgttcaagcgcatctccgagcagttctcagccatgttccggcgcaaggccttcctgcactggttcacgggtgagggcatggatgaaatggagttcaccgaggcggagagcaacatgaacgacctggtatccgagtaccagcagtaccaggatgccaccgccaatgacggggaggaagcttttgaggatgaggaagaggagatcgatggatag
Sequence Length
1341
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,857 Da
NCBI Official Full Name
Homo sapiens tubulin, beta 6, mRNA
NCBI Official Synonym Full Names
tubulin beta 6 class V
NCBI Official Symbol
TUBB6
NCBI Official Synonym Symbols
TUBB-5; HsT1601
NCBI Protein Information
tubulin beta-6 chain
UniProt Protein Name
Tubulin beta-6 chain
Protein Family
UniProt Gene Name
TUBB6
UniProt Entry Name
TBB6_HUMAN

Uniprot Description

TUBB6: Tubulin is the major constituent of microtubules. It binds two moles of GTP, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha-chain. Belongs to the tubulin family.

Protein type: Cytoskeletal

Chromosomal Location of Human Ortholog: 18p11.21

Cellular Component: microtubule; nucleus

Research Articles on TUBB6

Similar Products

Product Notes

The TUBB6 tubb6 (Catalog #AAA1270100) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagggaga tcgtgcacat ccaggcgggc cagtgcggga accagatcgg caccaagttt tgggaagtga tcagcgatga gcacggcatc gacccggccg gaggctacgt gggagactcg gcgctgcagc tggagagaat caacgtctac tacaatgagt catcgtctca gaaatatgtg cccagggccg ccctggtgga cttagagcca ggcaccatgg acagcgtgcg gtctgggcct tttgggcagc ttttccggcc tgacaacttc atctttggcc agacgggtgc agggaacaac tgggcgaaag ggcactacac ggagggcgcg gagctggtgg acgcagtgct ggacgtggtg cggaaggagt gcgagcactg cgactgcctg cagggcttcc agctcacgca ctcgctgggc ggcggcacgg gctcaggcat gggcacgctg ctcatcagca agatccgtga ggagttcccg gaccgcatca tgaacacctt cagcgtcatg ccctcgccca aggtgtcgga cacggtggtg gagccctaca atgccacact gtcggtgcac cagctggtgg agaatacaga cgagacctac tgcatcgaca acgaggcgct ctatgacatc tgcttccgca ctctgaagct gacaacgccc acctacgggg acctcaacca cctggtgtcc gccaccatga gtggggtcac cacctcgctg cgcttcccgg gccagctcaa tgctgacctg cgcaagctgg cggtgaacat ggtgcccttc ccgcgcctgc acttcttcat gcctggcttc gcgccgctca ccagccgcgg cagccagcag taccgggccc tgaccgtgcc cgagctcacc cagcagatgt tcgacgccag gaacatgatg gccgcctgcg atccgcgcca tggccgctac ctgaccgtgg ccaccgtgtt ccgcgggccc atgtccatga aggaggtgga cgagcagatg ctggccatcc agagtaagaa cagcagctac ttcgtggagt ggattcccaa caacgtgaag gtggccgtgt gcgacatccc gccccgcggc ctgaagatgg cctccacctt catcggcaac agcacggcca tccaggagct gttcaagcgc atctccgagc agttctcagc catgttccgg cgcaaggcct tcctgcactg gttcacgggt gagggcatgg atgaaatgga gttcaccgag gcggagagca acatgaacga cctggtatcc gagtaccagc agtaccagga tgccaccgcc aatgacgggg aggaagcttt tgaggatgag gaagaggaga tcgatggata g. It is sometimes possible for the material contained within the vial of "TUBB6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.