Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TTC26 cdna clone

TTC26 cDNA Clone

Gene Names
TTC26; DYF13; IFT56; dyf-13
Synonyms
TTC26; TTC26 cDNA Clone; TTC26 cdna clone
Ordering
For Research Use Only!
Sequence
atgatgctttcaagggccaaacctgctgtaggcagaggcgtacagcacactgacaaaagaaagaagaaaggtaggaagattccaaaactagaggagctactttcaaaaagagatttcactggagctattaccctgttggagttcaaacgtcatgttggggaagaagaagaggatactaatttgtggattggatattgtgcctttcacctgggtgactacaagagagctctggaggaatacgaaaatgctacaaaagaggaaaattgtaattctgaagtctgggtgaacctagcttgcacctacttctttcttgggatgtataaacaagctgaagcagctggatttaaagcttcaaaaagccgactccaaaaccgcctcctcttccacttggctcacaagtttaatgatgagaaaaaattgatgagctttcatcaaaatcttcaggatgtcacagaagatcaactcagtttggcctcaatccactatatgcgatctcactaccaagaagctatagatatatataagcgaatactgctagataacagggaataccttgcccttaatgtttatgtggccctctgctactacaagttggattactatgatgtgtctcaagaagttttggctgtttaccttcagcaaattcctgatagtaccatcgcactcaatcttaaagcctgtaaccattttcgcctttacaatggcagagcagctgaggcagaactcaaaagcttgatggacaatgcttcttcatcctttgaatttgctaaagaactcatcaggcacaatctggttgttttccgaggaggtgaaggggctttgcaggttttacctcccctagttgatgtcattcctgaagctaggctaaacttggtgatttactaccttcgtcaagatgatgtacaagaagcttataacttaattaaggatctggaacctactactcctcaggagtatattctcaaaggagtggtcaatgcagcccttggccaggaaatgggttcaagggatcatatgaaaattgcccagcagttcttccagttggtgggaggatcagctagtgaatgtgatacaataccagggaggcagtgcatggcttcctgtttcttcctgcttaagcaatttgatgatgttttgatttacctcaactcatttaagagttacttctataatgatgacatctttaactttaattatgcccaagccaaagctgcaacaggcaataccagtgagggcgaagaggcgttcctcttgatccaaagtgagaagatgaaaaatgattacatttacctcagctggttagctcggtgctatattatgaataagaaaccaagactagcctgggaactttatcttaagatggaaacctccggcgagtccttcagtctcttacagctcattgctaatgactgctacaagatgggccagttttactattctgccaaagcttttgatgtccttgagaggctggatcctaaccctgaatattgggaaggcaaacggggtgcctgtgtgggcattttccagatgatcatagctgggagagaacccaaagagacccttcgagaagtgctccatttactgagaagcacaggtaacacccaagtagaatacatgatccggatcatgaagaaatgggccaaagaaaacagagtgtccatctaa
Sequence Length
1665
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,469 Da
NCBI Official Full Name
Homo sapiens tetratricopeptide repeat domain 26, mRNA
NCBI Official Synonym Full Names
tetratricopeptide repeat domain 26
NCBI Official Symbol
TTC26
NCBI Official Synonym Symbols
DYF13; IFT56; dyf-13
NCBI Protein Information
intraflagellar transport protein 56
UniProt Protein Name
Intraflagellar transport protein 56
UniProt Gene Name
TTC26
UniProt Synonym Gene Names
TPR repeat protein 26
UniProt Entry Name
IFT56_HUMAN

Uniprot Description

TTC26: May play a critical role in ciliogenesis and normal cilia function. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 7q34

Biological Process: cilium biogenesis; intraflagellar transport; smoothened signaling pathway

Research Articles on TTC26

Similar Products

Product Notes

The TTC26 ttc26 (Catalog #AAA1275616) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgcttt caagggccaa acctgctgta ggcagaggcg tacagcacac tgacaaaaga aagaagaaag gtaggaagat tccaaaacta gaggagctac tttcaaaaag agatttcact ggagctatta ccctgttgga gttcaaacgt catgttgggg aagaagaaga ggatactaat ttgtggattg gatattgtgc ctttcacctg ggtgactaca agagagctct ggaggaatac gaaaatgcta caaaagagga aaattgtaat tctgaagtct gggtgaacct agcttgcacc tacttctttc ttgggatgta taaacaagct gaagcagctg gatttaaagc ttcaaaaagc cgactccaaa accgcctcct cttccacttg gctcacaagt ttaatgatga gaaaaaattg atgagctttc atcaaaatct tcaggatgtc acagaagatc aactcagttt ggcctcaatc cactatatgc gatctcacta ccaagaagct atagatatat ataagcgaat actgctagat aacagggaat accttgccct taatgtttat gtggccctct gctactacaa gttggattac tatgatgtgt ctcaagaagt tttggctgtt taccttcagc aaattcctga tagtaccatc gcactcaatc ttaaagcctg taaccatttt cgcctttaca atggcagagc agctgaggca gaactcaaaa gcttgatgga caatgcttct tcatcctttg aatttgctaa agaactcatc aggcacaatc tggttgtttt ccgaggaggt gaaggggctt tgcaggtttt acctccccta gttgatgtca ttcctgaagc taggctaaac ttggtgattt actaccttcg tcaagatgat gtacaagaag cttataactt aattaaggat ctggaaccta ctactcctca ggagtatatt ctcaaaggag tggtcaatgc agcccttggc caggaaatgg gttcaaggga tcatatgaaa attgcccagc agttcttcca gttggtggga ggatcagcta gtgaatgtga tacaatacca gggaggcagt gcatggcttc ctgtttcttc ctgcttaagc aatttgatga tgttttgatt tacctcaact catttaagag ttacttctat aatgatgaca tctttaactt taattatgcc caagccaaag ctgcaacagg caataccagt gagggcgaag aggcgttcct cttgatccaa agtgagaaga tgaaaaatga ttacatttac ctcagctggt tagctcggtg ctatattatg aataagaaac caagactagc ctgggaactt tatcttaaga tggaaacctc cggcgagtcc ttcagtctct tacagctcat tgctaatgac tgctacaaga tgggccagtt ttactattct gccaaagctt ttgatgtcct tgagaggctg gatcctaacc ctgaatattg ggaaggcaaa cggggtgcct gtgtgggcat tttccagatg atcatagctg ggagagaacc caaagagacc cttcgagaag tgctccattt actgagaagc acaggtaaca cccaagtaga atacatgatc cggatcatga agaaatgggc caaagaaaac agagtgtcca tctaa. It is sometimes possible for the material contained within the vial of "TTC26, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.