Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TSC22D3 cdna clone

TSC22D3 cDNA Clone

Gene Names
TSC22D3; DIP; GILZ; DSIPI; TSC-22R
Synonyms
TSC22D3; TSC22D3 cDNA Clone; TSC22D3 cdna clone
Ordering
For Research Use Only!
Sequence
atggatctggtgaagaatcatctgatgtatgctgtgagagaggaggtggagatcctgaaggagcagatccgagagctggtggagaagaactcccagctagagcgtgagaacaccctgttgaagaccctggcaagcccagagcagctggagaagttccagtcctgtctgagccctgaagagccagctcccgaatccccacaagtgcccgaggcccctggtggttctgcggtgtaa
Sequence Length
234
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,286 Da
NCBI Official Full Name
Homo sapiens TSC22 domain family, member 3, mRNA
NCBI Official Synonym Full Names
TSC22 domain family member 3
NCBI Official Symbol
TSC22D3
NCBI Official Synonym Symbols
DIP; GILZ; DSIPI; TSC-22R
NCBI Protein Information
TSC22 domain family protein 3
UniProt Protein Name
TSC22 domain family protein 3
UniProt Gene Name
TSC22D3
UniProt Synonym Gene Names
DSIPI; GILZ; Protein DIP; hDIP; GILZ; TSC-22R
UniProt Entry Name
T22D3_HUMAN

NCBI Description

This gene encodes the anti-inflammatory protein glucocorticoid (GC)-induced leucine zipper. Expression of this gene stimulated by glucocorticoids and interleukin 10 and it appears to play a key role in the anti-inflammatory and immunosuppressive effects of this steroid. This protein has also been shown to inhibit pro-inflammatory molecules including nuclear factor κB. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]

Uniprot Description

GILZ: Protects T-cells from IL2 deprivation-induced apoptosis through the inhibition of FOXO3A transcriptional activity that leads to the down-regulation of the pro-apoptotic factor BCL2L11. In macrophages, plays a role in the anti-inflammatory and immunosuppressive effects of glucocorticoids and IL10. In T-cells, inhibits anti-CD3-induced NFKB1 nuclear translocation. In vitro, suppresses AP1 and NFKB1 DNA-binding activities. Belongs to the TSC-22/Dip/Bun family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding

Chromosomal Location of Human Ortholog: Xq22.3

Cellular Component: cytoplasm; cytosol; nucleus

Biological Process: regulation of transcription, DNA-dependent

Research Articles on TSC22D3

Similar Products

Product Notes

The TSC22D3 tsc22d3 (Catalog #AAA1271544) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatctgg tgaagaatca tctgatgtat gctgtgagag aggaggtgga gatcctgaag gagcagatcc gagagctggt ggagaagaac tcccagctag agcgtgagaa caccctgttg aagaccctgg caagcccaga gcagctggag aagttccagt cctgtctgag ccctgaagag ccagctcccg aatccccaca agtgcccgag gcccctggtg gttctgcggt gtaa. It is sometimes possible for the material contained within the vial of "TSC22D3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.