Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRPV5 cdna clone

TRPV5 cDNA Clone

Gene Names
TRPV5; CAT2; ECAC1; OTRPC3
Synonyms
TRPV5; TRPV5 cDNA Clone; TRPV5 cdna clone
Ordering
For Research Use Only!
Sequence
atggggggttttctacctaaggcagaagggcccgggagccaactccagaaacttctgccctcctttctggtcagagaacaagactgggaccagcacctggacaagcttcatatgctgcagcagaagaggattctagagtctccactgcttcgagcatccaaggaaaatgacctgtctgttcttaggcaacttctactggactgcacctgtgacgttcgacaaagaggagccctgggggagacggcgctgcacatagcagccctctatgacaacttggaggcggccttggtgctgatggaggctgccccagagctggtctttgagcccaccacatgtgaggcttttgcaggtcagactgcactgcacatcgctgttgtgaaccagaatgtgaacctggtgcgtgccctgctcacccgcagggccagtgtctctgccagagccacaggcactgccttccgccatagtccccgcaacctcatctactttggggagcaccctttgtcctttgctgcctgtgtgaacagcgaggagatcgtgcggctgctcattgagcatggagctgacatcagggcccaggactccctgggaaacacagtattacacatcctcatcctccagcccaacaaaacctttgcctgccagatgtacaacctgctgctgtcctatgatggacatggggaccacctgcagcccctggaccttgtgcccaatcaccagggtctcacccccttcaagctggctggagtggagggtaacactgtgatgttccagcacctgatgcagaagcggaggcacatccagtggacgtatggacccctgacctccattctctacgacctcacggagatcgactcctggggagaggagctgtccttcctggagcttgtggtctcctctgataaacgagaggctcgccaaattctggaacagaccccagtgaaggagctggtgagcttcaagtggaacaagtatggccggccgtacttctgcatcctggctgccttgtacctgctctacatgatctgctttactacgtgctgcgtctaccgcccccttaagtttcgtggtggcaaccgcactcattctcgagacatcaccatcctccagcaaaaactactacaggtgattctcctcagaaggggatga
Sequence Length
1146
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,186 Da
NCBI Official Full Name
Homo sapiens transient receptor potential cation channel, subfamily V, member 5, mRNA
NCBI Official Synonym Full Names
transient receptor potential cation channel subfamily V member 5
NCBI Official Symbol
TRPV5
NCBI Official Synonym Symbols
CAT2; ECAC1; OTRPC3
NCBI Protein Information
transient receptor potential cation channel subfamily V member 5
UniProt Protein Name
Transient receptor potential cation channel subfamily V member 5
UniProt Gene Name
TRPV5
UniProt Synonym Gene Names
ECAC1; TrpV5; CaT2; ECaC; ECaC1; OTRPC3
UniProt Entry Name
TRPV5_HUMAN

NCBI Description

This gene is a member of the transient receptor family and the TrpV subfamily. The calcium-selective channel encoded by this gene has 6 transmembrane-spanning domains, multiple potential phosphorylation sites, an N-linked glycosylation site, and 5 ANK repeats. This protein forms homotetramers or heterotetramers and is activated by a low internal calcium level. [provided by RefSeq, Jul 2008]

Uniprot Description

TRPV5: Constitutively active calcium selective cation channel thought to be involved in Ca(2+) reabsorption in kidney and intestine. The channel is activated by low internal calcium level and the current exhibits an inward rectification. A Ca(2+)- dependent feedback regulation includes fast channel inactivation and slow current decay. Heteromeric assembly with TRPV6 seems to modify channel properties. TRPV5-TRPV6 heteromultimeric concatemers exhibit voltage-dependent gating. Belongs to the transient receptor (TC 1.A.4) family. TrpV subfamily. TRPV5 sub-subfamily.

Protein type: Membrane protein, integral; Motility/polarity/chemotaxis; Channel, cation; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 7q35

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: calcium channel activity; protein binding

Biological Process: calcium ion transport; protein tetramerization

Research Articles on TRPV5

Similar Products

Product Notes

The TRPV5 trpv5 (Catalog #AAA1275732) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggggtt ttctacctaa ggcagaaggg cccgggagcc aactccagaa acttctgccc tcctttctgg tcagagaaca agactgggac cagcacctgg acaagcttca tatgctgcag cagaagagga ttctagagtc tccactgctt cgagcatcca aggaaaatga cctgtctgtt cttaggcaac ttctactgga ctgcacctgt gacgttcgac aaagaggagc cctgggggag acggcgctgc acatagcagc cctctatgac aacttggagg cggccttggt gctgatggag gctgccccag agctggtctt tgagcccacc acatgtgagg cttttgcagg tcagactgca ctgcacatcg ctgttgtgaa ccagaatgtg aacctggtgc gtgccctgct cacccgcagg gccagtgtct ctgccagagc cacaggcact gccttccgcc atagtccccg caacctcatc tactttgggg agcacccttt gtcctttgct gcctgtgtga acagcgagga gatcgtgcgg ctgctcattg agcatggagc tgacatcagg gcccaggact ccctgggaaa cacagtatta cacatcctca tcctccagcc caacaaaacc tttgcctgcc agatgtacaa cctgctgctg tcctatgatg gacatgggga ccacctgcag cccctggacc ttgtgcccaa tcaccagggt ctcaccccct tcaagctggc tggagtggag ggtaacactg tgatgttcca gcacctgatg cagaagcgga ggcacatcca gtggacgtat ggacccctga cctccattct ctacgacctc acggagatcg actcctgggg agaggagctg tccttcctgg agcttgtggt ctcctctgat aaacgagagg ctcgccaaat tctggaacag accccagtga aggagctggt gagcttcaag tggaacaagt atggccggcc gtacttctgc atcctggctg ccttgtacct gctctacatg atctgcttta ctacgtgctg cgtctaccgc ccccttaagt ttcgtggtgg caaccgcact cattctcgag acatcaccat cctccagcaa aaactactac aggtgattct cctcagaagg ggatga. It is sometimes possible for the material contained within the vial of "TRPV5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.