Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRPM8 cdna clone

TRPM8 cDNA Clone

Gene Names
TRPM8; TRPP8; LTRPC6
Synonyms
TRPM8; TRPM8 cDNA Clone; TRPM8 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaatccttccttcctgtccacaccatcgtgcttatcagggagaatgtgtgcaagtgtggctatgcccagagccagcacatggaaggcacccagatcaaccaaagtgagaaatggaactacaagaaacacaccaaggaatttcctaccgacgcctttggggatattcagtttgagacactggggaagaaagggaagtatatacgtctgtcctgcgacacggacgcggaaatcctttacgagctgctgacccagcactggcacctgaaaacacccaacctggtcatttctgtgaccgggggcgccaagaacttcgccctgaagccgcgcatgcgcaagatcttcagccggctcatctacatcgcgcagtccaaaggtgcttggattctcacgggaggcacccattatggcctgatgaagtacatcggggaggtggtgagagataacaccatcagcaggagttcagaggagaatattgtggccattggcatagcagcttggggcatggtctccaaccgggacaccctcatcaggaattgcgatgctgaggtaccggtgggacaggaggaggtctgctag
Sequence Length
579
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
79,096 Da
NCBI Official Full Name
Homo sapiens transient receptor potential cation channel, subfamily M, member 8, mRNA
NCBI Official Synonym Full Names
transient receptor potential cation channel subfamily M member 8
NCBI Official Symbol
TRPM8
NCBI Official Synonym Symbols
TRPP8; LTRPC6
NCBI Protein Information
transient receptor potential cation channel subfamily M member 8
UniProt Protein Name
Transient receptor potential cation channel subfamily M member 8
UniProt Gene Name
TRPM8
UniProt Synonym Gene Names
LTRPC6; TRPP8; LTrpC-6; LTrpC6; Trp-p8
UniProt Entry Name
TRPM8_HUMAN

Uniprot Description

TRPM8: Receptor-activated non-selective cation channel involved in detection of sensations such as coolness, by being activated by cold temperature below 25 degrees Celsius. Activated by icilin, eucalyptol, menthol, cold and modulation of intracellular pH. Involved in menthol sensation. Permeable for monovalent cations sodium, potassium, and cesium and divalent cation calcium. Temperature sensing is tightly linked to voltage-dependent gating. Activated upon depolarization, changes in temperature resulting in graded shifts of its voltage-dependent activation curves. The chemical agonists menthol functions as a gating modifier, shifting activation curves towards physiological membrane potentials. Temperature sensitivity arises from a tenfold difference in the activation energies associated with voltage-dependent opening and closing. Belongs to the transient receptor (TC 1.A.4) family. LTrpC subfamily. TRPM8 sub-subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Membrane protein, multi-pass; Channel, cation

Chromosomal Location of Human Ortholog: 2q37.1

Cellular Component: plasma membrane

Molecular Function: calcium channel activity; protein binding

Research Articles on TRPM8

Similar Products

Product Notes

The TRPM8 trpm8 (Catalog #AAA1274169) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaatcct tccttcctgt ccacaccatc gtgcttatca gggagaatgt gtgcaagtgt ggctatgccc agagccagca catggaaggc acccagatca accaaagtga gaaatggaac tacaagaaac acaccaagga atttcctacc gacgcctttg gggatattca gtttgagaca ctggggaaga aagggaagta tatacgtctg tcctgcgaca cggacgcgga aatcctttac gagctgctga cccagcactg gcacctgaaa acacccaacc tggtcatttc tgtgaccggg ggcgccaaga acttcgccct gaagccgcgc atgcgcaaga tcttcagccg gctcatctac atcgcgcagt ccaaaggtgc ttggattctc acgggaggca cccattatgg cctgatgaag tacatcgggg aggtggtgag agataacacc atcagcagga gttcagagga gaatattgtg gccattggca tagcagcttg gggcatggtc tccaaccggg acaccctcat caggaattgc gatgctgagg taccggtggg acaggaggag gtctgctag. It is sometimes possible for the material contained within the vial of "TRPM8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.