Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRPM4 cdna clone

TRPM4 cDNA Clone

Gene Names
TRPM4; LTrpC4; PFHB1B; TRPM4B; hTRPM4
Synonyms
TRPM4; TRPM4 cDNA Clone; TRPM4 cdna clone
Ordering
For Research Use Only!
Sequence
atggtggtgccggagaaggagcagagctggatccccaagatcttcaagaagaagacctgcacgacgttcatagttgactccacagatccgggagggaccttgtgccagtgtgggcgcccccggaccgcccaccccgcagtggccatggaggatgccttcggggcagccgtggtgaccgtgtgggacagcgatgcacacaccacggagaagcccaccgatgcctacggagagctggacttcacgggggccggccgcaagcacagcaatttcctccggctctctgaccgaacggatccagctgcagtttatagtctggtcacacgcacatggggcttccgtgccccgaacctggtggtgtcagtgctggggggatcggggggccccgtcctccagacctggctgcaggacctgctgcgtcgtgggctggtgcgggctgcccagagcacaggagcctggattgtcactgggggtctgcacacgggcatcggccggcatgttggtgtggctgtacgggaccatcagatggccagcactgggggcaccaaggtggtggccatgggtgtggccccctggggtgtggtccggaatagagacaccctcatcaaccccaagggctcgttccctgcgaggtaccggtggcgcggtgacccggaggacggggtccagtttcccctggactacaactactcggccttcttcctggtggacgacggcacacacggctgcctggggggcgagaaccgcttccgcttgcgcctggagtcctacatctcacagcagaagacgggcgtgggagggactggaattgacatccctgtcctgctcctcctgattgatggtgatgagaagatgttgacgcgaatagagaacgccacccaggctcagctcccatgtctcctcgtggctggctcagggggagctgcggactgcctggcggagaccctggaagacactctggccccagggagtgggggagccaggcaaggcgaagcccgagatcgaatcaggcgtttctttcccaaaggggaccttgaggtcctgcaggcccaggtggagaggattatgacccggaaggagctcctgacagtctattcttctgaggatgggtctgaggaattcgagaccatagttttgaaggcccttgtgaaggcctgtgggagctcggaggcctcagcctacctggatgagctgcgtttggctgtggcttggaaccgcgtggacattgcccagagtgaactctttcggggggacatccaatggcggtccttccatctcgaagcttccctcatggacgccctgctgaatgaccggcctgagttcgtgcgcttgctcatttcccacggcctcagcctgggccacttcctgaccccgatgcgcctggcccaactctacagcgcggcgccctccaactcgctcatccgcaaccttttggaccaggcgtcccacagcgcaggcaccaaagccccagccctaaaagggggagctgcggagctccggccccctgacgtggggcatgtgctgaggatgctgctggggaagatgtgcgcgccgaggtacccctccgggggcgcctgggaccctcacccaggccagggcttcggggagagcatgtatctgctctcggacaaggccacctcgccgctctcgctggatgctggcctcgggcaggccccctggagcgacctgcttctttgggcactgttgctgaacagggcacagatggccatgtacttctgggagatgggttccaatgcagtttcctcagctcttggggcctgtttgctgctccgggtgatggcacgcctggagcctgacgctgaggaggcagcacggaggaaagacctggcgttcaagtttgaggggatgggcgttgacctctttggcgagtgctatcgcagcagtgaggtgagggctgcccgcctcctcctccgtcgctgcccgctctggggggatgccacttgcctccagctggccatgcaagctgacgcccgtgccttctttgcccaggatggggtacagtctctgctgacacagaagtggtggggagatatggccagcactacacccatctgggccctggttctcgccttcttttgccctccactcatctacacccgcctcatcaccttcaggaaatcagaagaggagcccacacgggaggagctagagtttgacatggatagtgtcattaatggggaagggcctgtcgggacggcggacccagccgagaagacgccgctgggggtcccgcgccagtcgggccgtccgggttgctgcgggggccgctgcggggggcgccggtgcctacgccgctggttccacttctggggcgcgccggtgaccatcttcatgggcaacgtggtcagctacctgctgttcctgctgcttttctcgcgggtgctgctcgtggatttccagccggcgccgcccggctccctggagctgctgctctatttctgggctttcacgctgctgtgcgaggaactgcgccagggcctgagcggaggcgggggcagcctcgccagcgggggccccgggcctggccatgcctcactgagccagcgcctgcgcctctacctcgccgacagctggaaccagtgcgacctagtggctctcacctgcttcctcctgggcgtgggctgccggctgaccccgggtttgtaccacctgggccgcactgtcctctgcatcgacttcatggttttcacggtgcggctgcttcacatcttcacggtcaacaaacagctggggcccaagatcgtcatcgtgagcaagatgatgaaggacgtgttcttcttcctcttcttcctcggcgtgtggctggtagcctatggcgtggccacggaggggctcctgaggccacgggacagtgacttcccaagtatcctgcgccgcgtcttctaccgtccctacctgcagatcttcgggcagattccccaggaggacatggacgtggccctcatggagcacagcaactgctcgtcggagcccggcttctgggcacaccctcctggggcccaggcgggcacctgcgtctcccagtatgccaactggctggtggtgctgctcctcgtcatcttcctgctcgtggccaacatcctgctggtcaacttgctcattgccatgttcagttacacattcggcaaagtacagggcaacagcgatctctactggaaggcgcagcgttaccgcctcatccgggaattccactctcggcccgcgctggccccgccctttatcgtcatctcccacttgcgcctcctgctcaggcaattgtgcaggcgaccccggagcccccagccgtcctccccggccctcgagcatttccgggtttacctttctaaggaagccgagcggaagctgctaacgtgggaatcggtgcataaggagaactttctgctggcacgcgctagggacaagcgggagagcgactccgagcgtctgaagcgcacgtcccagaaggtggacttggcactgaaacagctgggacacatccgcgagtacgaacagcgcctgaaagtgctggagcgggaggtccagcagtgtagccgcgtcctggggtgggtggccgaggccctgagccgctctgccttgctgcccccaggtgggccgccaccccctgacctgcctgggtccaaagactga
Sequence Length
3645
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
118,630 Da
NCBI Official Full Name
Homo sapiens transient receptor potential cation channel, subfamily M, member 4, mRNA
NCBI Official Synonym Full Names
transient receptor potential cation channel subfamily M member 4
NCBI Official Symbol
TRPM4
NCBI Official Synonym Symbols
LTrpC4; PFHB1B; TRPM4B; hTRPM4
NCBI Protein Information
transient receptor potential cation channel subfamily M member 4
UniProt Protein Name
Transient receptor potential cation channel subfamily M member 4
UniProt Gene Name
TRPM4
UniProt Synonym Gene Names
LTRPC4; hTRPM4; LTrpC-4; LTrpC4
UniProt Entry Name
TRPM4_HUMAN

NCBI Description

The protein encoded by this gene is a calcium-activated nonselective ion channel that mediates transport of monovalent cations across membranes, thereby depolarizing the membrane. The activity of the encoded protein increases with increasing intracellular calcium concentration, but this channel does not transport calcium. [provided by RefSeq, Mar 2016]

Uniprot Description

TRPM4: Calcium-activated non selective (CAN) cation channel that mediates membrane depolarization. While it is activated by increase in intracellular Ca(2+), it is impermeable to it. Mediates transport of monovalent cations (Na(+) > K(+) > Cs(+) > Li(+)), leading to depolarize the membrane. It thereby plays a central role in cadiomyocytes, neurons from entorhinal cortex, dorsal root and vomeronasal neurons, endocrine pancreas cells, kidney epithelial cells, cochlea hair cells etc. Participates in T-cell activation by modulating Ca(2+) oscillations after T lymphocyte activation, which is required for NFAT-dependent IL2 production. Involved in myogenic constriction of cerebral arteries. Controls insulin secretion in pancreatic beta-cells. May also be involved in pacemaking or could cause irregular electrical activity under conditions of Ca(2+) overload. Affects T-helper 1 (Th1) and T-helper 2 (Th2) cell motility and cytokine production through differential regulation of calcium signaling and NFATC1 localization. Enhances cell proliferation through up-regulation of the beta-catenin signaling pathway. Defects in TRPM4 are the cause of progressive familial heart block type 1B (PFHB1B). It is a cardiac bundle branch disorder characterized by progressive alteration of cardiac conduction through the His-Purkinje system, with a pattern of a right bundle-branch block and/or left anterior hemiblock occurring individually or together. It leads to complete atrioventricular block causing syncope and sudden death. Belongs to the transient receptor (TC 1.A.4) family. LTrpC subfamily. TRPM4 sub-subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 19q13.33

Cellular Component: cell soma; cytosol; endoplasmic reticulum; Golgi apparatus; nucleoplasm; plasma membrane

Molecular Function: calcium activated cation channel activity; sodium channel activity

Biological Process: dendritic cell chemotaxis; elevation of cytosolic calcium ion concentration; negative regulation of bone mineralization; negative regulation of osteoblast differentiation; positive regulation of cell proliferation; positive regulation of fat cell differentiation; positive regulation of heart rate; positive regulation of vasoconstriction; protein sumoylation; regulation of T cell cytokine production

Disease: Progressive Familial Heart Block, Type Ib

Research Articles on TRPM4

Similar Products

Product Notes

The TRPM4 trpm4 (Catalog #AAA1276442) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtggtgc cggagaagga gcagagctgg atccccaaga tcttcaagaa gaagacctgc acgacgttca tagttgactc cacagatccg ggagggacct tgtgccagtg tgggcgcccc cggaccgccc accccgcagt ggccatggag gatgccttcg gggcagccgt ggtgaccgtg tgggacagcg atgcacacac cacggagaag cccaccgatg cctacggaga gctggacttc acgggggccg gccgcaagca cagcaatttc ctccggctct ctgaccgaac ggatccagct gcagtttata gtctggtcac acgcacatgg ggcttccgtg ccccgaacct ggtggtgtca gtgctggggg gatcgggggg ccccgtcctc cagacctggc tgcaggacct gctgcgtcgt gggctggtgc gggctgccca gagcacagga gcctggattg tcactggggg tctgcacacg ggcatcggcc ggcatgttgg tgtggctgta cgggaccatc agatggccag cactgggggc accaaggtgg tggccatggg tgtggccccc tggggtgtgg tccggaatag agacaccctc atcaacccca agggctcgtt ccctgcgagg taccggtggc gcggtgaccc ggaggacggg gtccagtttc ccctggacta caactactcg gccttcttcc tggtggacga cggcacacac ggctgcctgg ggggcgagaa ccgcttccgc ttgcgcctgg agtcctacat ctcacagcag aagacgggcg tgggagggac tggaattgac atccctgtcc tgctcctcct gattgatggt gatgagaaga tgttgacgcg aatagagaac gccacccagg ctcagctccc atgtctcctc gtggctggct cagggggagc tgcggactgc ctggcggaga ccctggaaga cactctggcc ccagggagtg ggggagccag gcaaggcgaa gcccgagatc gaatcaggcg tttctttccc aaaggggacc ttgaggtcct gcaggcccag gtggagagga ttatgacccg gaaggagctc ctgacagtct attcttctga ggatgggtct gaggaattcg agaccatagt tttgaaggcc cttgtgaagg cctgtgggag ctcggaggcc tcagcctacc tggatgagct gcgtttggct gtggcttgga accgcgtgga cattgcccag agtgaactct ttcgggggga catccaatgg cggtccttcc atctcgaagc ttccctcatg gacgccctgc tgaatgaccg gcctgagttc gtgcgcttgc tcatttccca cggcctcagc ctgggccact tcctgacccc gatgcgcctg gcccaactct acagcgcggc gccctccaac tcgctcatcc gcaacctttt ggaccaggcg tcccacagcg caggcaccaa agccccagcc ctaaaagggg gagctgcgga gctccggccc cctgacgtgg ggcatgtgct gaggatgctg ctggggaaga tgtgcgcgcc gaggtacccc tccgggggcg cctgggaccc tcacccaggc cagggcttcg gggagagcat gtatctgctc tcggacaagg ccacctcgcc gctctcgctg gatgctggcc tcgggcaggc cccctggagc gacctgcttc tttgggcact gttgctgaac agggcacaga tggccatgta cttctgggag atgggttcca atgcagtttc ctcagctctt ggggcctgtt tgctgctccg ggtgatggca cgcctggagc ctgacgctga ggaggcagca cggaggaaag acctggcgtt caagtttgag gggatgggcg ttgacctctt tggcgagtgc tatcgcagca gtgaggtgag ggctgcccgc ctcctcctcc gtcgctgccc gctctggggg gatgccactt gcctccagct ggccatgcaa gctgacgccc gtgccttctt tgcccaggat ggggtacagt ctctgctgac acagaagtgg tggggagata tggccagcac tacacccatc tgggccctgg ttctcgcctt cttttgccct ccactcatct acacccgcct catcaccttc aggaaatcag aagaggagcc cacacgggag gagctagagt ttgacatgga tagtgtcatt aatggggaag ggcctgtcgg gacggcggac ccagccgaga agacgccgct gggggtcccg cgccagtcgg gccgtccggg ttgctgcggg ggccgctgcg gggggcgccg gtgcctacgc cgctggttcc acttctgggg cgcgccggtg accatcttca tgggcaacgt ggtcagctac ctgctgttcc tgctgctttt ctcgcgggtg ctgctcgtgg atttccagcc ggcgccgccc ggctccctgg agctgctgct ctatttctgg gctttcacgc tgctgtgcga ggaactgcgc cagggcctga gcggaggcgg gggcagcctc gccagcgggg gccccgggcc tggccatgcc tcactgagcc agcgcctgcg cctctacctc gccgacagct ggaaccagtg cgacctagtg gctctcacct gcttcctcct gggcgtgggc tgccggctga ccccgggttt gtaccacctg ggccgcactg tcctctgcat cgacttcatg gttttcacgg tgcggctgct tcacatcttc acggtcaaca aacagctggg gcccaagatc gtcatcgtga gcaagatgat gaaggacgtg ttcttcttcc tcttcttcct cggcgtgtgg ctggtagcct atggcgtggc cacggagggg ctcctgaggc cacgggacag tgacttccca agtatcctgc gccgcgtctt ctaccgtccc tacctgcaga tcttcgggca gattccccag gaggacatgg acgtggccct catggagcac agcaactgct cgtcggagcc cggcttctgg gcacaccctc ctggggccca ggcgggcacc tgcgtctccc agtatgccaa ctggctggtg gtgctgctcc tcgtcatctt cctgctcgtg gccaacatcc tgctggtcaa cttgctcatt gccatgttca gttacacatt cggcaaagta cagggcaaca gcgatctcta ctggaaggcg cagcgttacc gcctcatccg ggaattccac tctcggcccg cgctggcccc gccctttatc gtcatctccc acttgcgcct cctgctcagg caattgtgca ggcgaccccg gagcccccag ccgtcctccc cggccctcga gcatttccgg gtttaccttt ctaaggaagc cgagcggaag ctgctaacgt gggaatcggt gcataaggag aactttctgc tggcacgcgc tagggacaag cgggagagcg actccgagcg tctgaagcgc acgtcccaga aggtggactt ggcactgaaa cagctgggac acatccgcga gtacgaacag cgcctgaaag tgctggagcg ggaggtccag cagtgtagcc gcgtcctggg gtgggtggcc gaggccctga gccgctctgc cttgctgccc ccaggtgggc cgccaccccc tgacctgcct gggtccaaag actga. It is sometimes possible for the material contained within the vial of "TRPM4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.