Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIP13 cdna clone

TRIP13 cDNA Clone

Gene Names
TRIP13; 16E1BP
Synonyms
TRIP13; TRIP13 cDNA Clone; TRIP13 cdna clone
Ordering
For Research Use Only!
Sequence
atggacgaggccgtgggcgacctgaagcaggcgcttccctgtgtggccgagtcgccaacggtccacgtggaggtgcatcagcgcggcagcagcactgcaaagaaagaagacataaacctgagtgttagaaagctactcaacagacataatattgtgtttggtgattacacatggactgagtttgatgaaccttttttgaccagaaatgtgcagtctgtgtctattattgacacagaattaaaggttaaagactcacagcccatcgatttgagtgcatgcactgttgcacttcacattttccagctgaatgaagatggccccagcagtgaaaatctggaggaagagacagaaaacataattgcagcaaatcactgggttctacctgcagctgaattccatgggctttgggacagcttggtatacgatgtggaagtcaaatcccatctcctcgattatgtgatgacaactttactgttttcagacaagaacgtcaacagcaacctcatcacctggaaccgggtggtgctgctccacggtcctcctggcactggaaaaacatccctgtgtaaagcgttagcccagaaattgacaattagactttcaagcaggtaccgatatggccaattaattgaaataaacagccacagcctcttttctaagtggttttcggaaagtggcaagctggtaaccaagatgtttcagaagattcaggatttgattgatgataaagacgccctggtgttcgtgctgattgatgaggtggagagtctcacagccgcccgaaatgcctgcagggcgggcaccgagccatcagatgccatccgcgtggtcaatgctgtcttgacccaaattgatcagattaaaaggcattccaatgttgtgattctgaccacttctaacatcaccgagaagatcgacgtggccttcgtggacagggctgacatcaagcagtacattgggccaccctctgcagcagccatcttcaaaatctacctctcttgtttggaagaactgatgaagtgtcagatcatataccctcgccagcagctgctgaccctccgagagctagagatgattggcttcattgaaaacaacgtgtcaaaattgagccttcttttgaatgacatttcaaggaagagcgagggcctcagcggccgggtcctgagaaaactcccctttctggctcatgcgctgtatgtccaggcccccaccgtcaccatagaggggttcctccaggccctgtctctggcagtggacaagcagtttgaagagagaaagaagcttgcagcttacatctga
Sequence Length
1299
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,084 Da
NCBI Official Full Name
Homo sapiens thyroid hormone receptor interactor 13, mRNA
NCBI Official Synonym Full Names
thyroid hormone receptor interactor 13
NCBI Official Symbol
TRIP13
NCBI Official Synonym Symbols
16E1BP
NCBI Protein Information
pachytene checkpoint protein 2 homolog
UniProt Protein Name
Pachytene checkpoint protein 2 homolog
UniProt Gene Name
TRIP13
UniProt Synonym Gene Names
PCH2; 16E1-BP; HPV16 E1 protein-binding protein; TR-interacting protein 13; TRIP-13
UniProt Entry Name
PCH2_HUMAN

NCBI Description

This gene encodes a protein that interacts with thyroid hormone receptors, also known as hormone-dependent transcription factors. The gene product interacts specifically with the ligand binding domain. This gene is one of several that may play a role in early-stage non-small cell lung cancer. [provided by RefSeq, Oct 2009]

Uniprot Description

TRIP13: Plays a key role in chromosome recombination and chromosome structure development during meiosis. Required at early steps in meiotic recombination that leads to non-crossovers pathways. Also needed for efficient completion of homologous synapsis by influencing crossover distribution along the chromosomes affecting both crossovers and non-crossovers pathways. Also required for development of higher-order chromosome structures and is needed for synaptonemal-complex formation. In males, required for efficient synapsis of the sex chromosomes and for sex body formation. Promotes early steps of the DNA double- strand breaks (DSBs) repair process upstream of the assembly of RAD51 complexes. Required for depletion of HORMAD1 and HORMAD2 from synapsed chromosomes. Belongs to the AAA ATPase family. PCH2 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription, coactivator/corepressor; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 5p15.33

Cellular Component: nucleus

Molecular Function: identical protein binding; protein binding; transcription cofactor activity

Biological Process: double-strand break repair; meiotic recombination; oogenesis; spermatogenesis; synaptonemal complex assembly; transcription from RNA polymerase II promoter

Research Articles on TRIP13

Similar Products

Product Notes

The TRIP13 trip13 (Catalog #AAA1276971) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgagg ccgtgggcga cctgaagcag gcgcttccct gtgtggccga gtcgccaacg gtccacgtgg aggtgcatca gcgcggcagc agcactgcaa agaaagaaga cataaacctg agtgttagaa agctactcaa cagacataat attgtgtttg gtgattacac atggactgag tttgatgaac cttttttgac cagaaatgtg cagtctgtgt ctattattga cacagaatta aaggttaaag actcacagcc catcgatttg agtgcatgca ctgttgcact tcacattttc cagctgaatg aagatggccc cagcagtgaa aatctggagg aagagacaga aaacataatt gcagcaaatc actgggttct acctgcagct gaattccatg ggctttggga cagcttggta tacgatgtgg aagtcaaatc ccatctcctc gattatgtga tgacaacttt actgttttca gacaagaacg tcaacagcaa cctcatcacc tggaaccggg tggtgctgct ccacggtcct cctggcactg gaaaaacatc cctgtgtaaa gcgttagccc agaaattgac aattagactt tcaagcaggt accgatatgg ccaattaatt gaaataaaca gccacagcct cttttctaag tggttttcgg aaagtggcaa gctggtaacc aagatgtttc agaagattca ggatttgatt gatgataaag acgccctggt gttcgtgctg attgatgagg tggagagtct cacagccgcc cgaaatgcct gcagggcggg caccgagcca tcagatgcca tccgcgtggt caatgctgtc ttgacccaaa ttgatcagat taaaaggcat tccaatgttg tgattctgac cacttctaac atcaccgaga agatcgacgt ggccttcgtg gacagggctg acatcaagca gtacattggg ccaccctctg cagcagccat cttcaaaatc tacctctctt gtttggaaga actgatgaag tgtcagatca tataccctcg ccagcagctg ctgaccctcc gagagctaga gatgattggc ttcattgaaa acaacgtgtc aaaattgagc cttcttttga atgacatttc aaggaagagc gagggcctca gcggccgggt cctgagaaaa ctcccctttc tggctcatgc gctgtatgtc caggccccca ccgtcaccat agaggggttc ctccaggccc tgtctctggc agtggacaag cagtttgaag agagaaagaa gcttgcagct tacatctga. It is sometimes possible for the material contained within the vial of "TRIP13, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.