Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIP10 cdna clone

TRIP10 cDNA Clone

Gene Names
TRIP10; STP; CIP4; HSTP; STOT; TRIP-10
Synonyms
TRIP10; TRIP10 cDNA Clone; TRIP10 cdna clone
Ordering
For Research Use Only!
Sequence
atggattggggcactgagctgtgggatcagttcgaggtgctcgagcgccacacgcagtgggggctggacctgttggacagatatgtaaagttcgtgaaagaacgcaccgaagtggaacaggcttacgccaaacaactgcggagcctggtgaaaaaatatctgcccaagagacctgccaaggatgatcctgagtccaaattcagccagcaacagtccttcgtacagattctccaggaggtgaatgactttgcaggccagcgggagctggtggctgagaacctcagtgtccgtgtatgtcttgagctgaccaagtactcacaagagatgaaacaggagaggaagatgcacttccaagaagggcggcgggcccagcagcagctggaaaatggctttaaacagctggagaatagtaagcgtaaatttgagcgggactgccgggaggcagagaaggcagcccagactgctgaacggctagaccaggatatcaacgccaccaaggctgatgtggagaaggccaagcagcaagcccaccttcggagtcacatggccgaagaaagcaaaaacgaatatgcggctcaactgcagcgcttcaaccgagaccaagcccacttctatttttcacagatgccccagatattcgataagctccaagacatggatgaacgcagggccacccgcctgggtgccgggtatgggctcctgtcggaggccgagctggaggtggtgcccataatagccaagtgcttggagggcatgaaggtggctgcaaatgctgtggatcccaagaacgactcccacgtccttatagagctgcacaagtcaggttttgcccgcccgggcgacgtggaattcgaggacttcagccagcccatgaaccgtgcaccctccgacagcagtctgggcaccccctcggatggacggcctgaactccgaggcccgggtcgcagccgcaccaagcgctggccttttggcaagaagaacaagacagtggtgaccgaggattttagccacttgcccccagagcagcagcgaaaacggcttcaacagcagttggaagaacgcagtcgtgaacttcagaaggaggttgaccagagggaagccctaaagaaaatgaaggatgtctatgagaagacacctcagatgggggaccccgccagcttggagccccagatcgctgaaaccctgagcaacattgaacggctgaaattggaagtgcagaagtatgaggcgtggctggcagaagctgaaagtcgagtccttagcaaccggggagacagcctgagccggcacgcccggcctcccgacccccccgctagcgccccgccagacagcagcagcaacagcgcatcacaggacaccaaggagagctctgaagagcctccctcagaagagagccaggacacccccatttacacggagtttgatgaggatttcgaggaggaacccacatcccccataggtcactgtgtggccatctaccactttgaagggtccagcgagggcactatctctatggccgagggtgaagacctcagtcttatggaagaagacaaaggggacggctggacccgggtcaggcggaaagagggaggcgagggctacgtgcccacctcctacctccgagtcacgctcaattga
Sequence Length
1638
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,583 Da
NCBI Official Full Name
Homo sapiens thyroid hormone receptor interactor 10, mRNA
NCBI Official Synonym Full Names
thyroid hormone receptor interactor 10
NCBI Official Symbol
TRIP10
NCBI Official Synonym Symbols
STP; CIP4; HSTP; STOT; TRIP-10
NCBI Protein Information
cdc42-interacting protein 4
UniProt Protein Name
Cdc42-interacting protein 4
Protein Family
UniProt Gene Name
TRIP10
UniProt Synonym Gene Names
CIP4; STOT; STP; hSTP; TR-interacting protein 10; TRIP-10
UniProt Entry Name
CIP4_HUMAN

Uniprot Description

TRIP10: Required for translocation of GLUT4 to the plasma membrane in response to insulin signaling. Required to coordinate membrane tubulation with reorganization of the actin cytoskeleton during endocytosis. Binds to lipids such as phosphatidylinositol 4,5-bisphosphate and phosphatidylserine and promotes membrane invagination and the formation of tubules. Also promotes CDC42-induced actin polymerization by recruiting WASL/N- WASP which in turn activates the Arp2/3 complex. Actin polymerization may promote the fission of membrane tubules to form endocytic vesicles. Required for the formation of podosomes, actin-rich adhesion structures specific to monocyte-derived cells. May be required for the lysosomal retention of FASLG/FASL. Belongs to the FNBP1 family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Nuclear receptor co-regulator; Adaptor/scaffold; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: cytosol; intracellular membrane-bound organelle; nucleoplasm; trans-Golgi network

Molecular Function: ARF guanyl-nucleotide exchange factor activity; GTPase activator activity; identical protein binding; protein binding

Biological Process: regulation of small GTPase mediated signal transduction; signal transduction; vesicle-mediated transport

Research Articles on TRIP10

Similar Products

Product Notes

The TRIP10 trip10 (Catalog #AAA1276877) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggattggg gcactgagct gtgggatcag ttcgaggtgc tcgagcgcca cacgcagtgg gggctggacc tgttggacag atatgtaaag ttcgtgaaag aacgcaccga agtggaacag gcttacgcca aacaactgcg gagcctggtg aaaaaatatc tgcccaagag acctgccaag gatgatcctg agtccaaatt cagccagcaa cagtccttcg tacagattct ccaggaggtg aatgactttg caggccagcg ggagctggtg gctgagaacc tcagtgtccg tgtatgtctt gagctgacca agtactcaca agagatgaaa caggagagga agatgcactt ccaagaaggg cggcgggccc agcagcagct ggaaaatggc tttaaacagc tggagaatag taagcgtaaa tttgagcggg actgccggga ggcagagaag gcagcccaga ctgctgaacg gctagaccag gatatcaacg ccaccaaggc tgatgtggag aaggccaagc agcaagccca ccttcggagt cacatggccg aagaaagcaa aaacgaatat gcggctcaac tgcagcgctt caaccgagac caagcccact tctatttttc acagatgccc cagatattcg ataagctcca agacatggat gaacgcaggg ccacccgcct gggtgccggg tatgggctcc tgtcggaggc cgagctggag gtggtgccca taatagccaa gtgcttggag ggcatgaagg tggctgcaaa tgctgtggat cccaagaacg actcccacgt ccttatagag ctgcacaagt caggttttgc ccgcccgggc gacgtggaat tcgaggactt cagccagccc atgaaccgtg caccctccga cagcagtctg ggcaccccct cggatggacg gcctgaactc cgaggcccgg gtcgcagccg caccaagcgc tggccttttg gcaagaagaa caagacagtg gtgaccgagg attttagcca cttgccccca gagcagcagc gaaaacggct tcaacagcag ttggaagaac gcagtcgtga acttcagaag gaggttgacc agagggaagc cctaaagaaa atgaaggatg tctatgagaa gacacctcag atgggggacc ccgccagctt ggagccccag atcgctgaaa ccctgagcaa cattgaacgg ctgaaattgg aagtgcagaa gtatgaggcg tggctggcag aagctgaaag tcgagtcctt agcaaccggg gagacagcct gagccggcac gcccggcctc ccgacccccc cgctagcgcc ccgccagaca gcagcagcaa cagcgcatca caggacacca aggagagctc tgaagagcct ccctcagaag agagccagga cacccccatt tacacggagt ttgatgagga tttcgaggag gaacccacat cccccatagg tcactgtgtg gccatctacc actttgaagg gtccagcgag ggcactatct ctatggccga gggtgaagac ctcagtctta tggaagaaga caaaggggac ggctggaccc gggtcaggcg gaaagaggga ggcgagggct acgtgcccac ctcctacctc cgagtcacgc tcaattga. It is sometimes possible for the material contained within the vial of "TRIP10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.