TRIM56 cdna clone
TRIM56 cDNA Clone
Gene Names
TRIM56; RNF109
Synonyms
TRIM56; TRIM56 cDNA Clone; TRIM56 cdna clone
Sequence
atggtttcccacgggtcctcgccctccctcctggaggccctgagcagcgacttcctggcctgtaaaatctgcctggagcagctgcgggcacccaagacactgccctgcctgcatacctactgccaagactgcctggcacagctggcggatggcggccgcgtccgctgccccgagtgccgcgagacagtgcctgtgccgcccgagggtgtggcctccttcaagaccaacttcttcgtcaatgggctgctggacctggtgaaggcccgggcctgtggagacctgcgtgccgggaagccagcctgtgccctgtgtcccctggtgggtggcaccagcaccggggggccggccacggcccggtgcctggactgtgccgatgacttgtgccaggcctgtgccgacgggcaccgctgcacccgccagacccacacccaccgcgtggtggacctggtgggctacagggccgggtggtatgatgaggaggcccgggagcgccaagcggcccagtgtccccagcaccccggggaggcactgcgcttcctgtgccagccctgctcacagttgctgtgcagagagtgccgcctagacccccacctggaccacccctgcctgcctctggctgaagctgtgcgtgcccggaggccgggcctggagggactgctggccggtgtggacaataacctggtggagctggaggcagcgcggagggtggagaaggaggcgctagcccggctgcgggagcaggcggcccgggtggggactcaggtggaggaggcggctgagggcgtcctccgggccctgctggcccagaagcaggaggtgctggggcagctacgagcccacgtggaggctgccgaagaagctgctcgggagaggctggcggagcttgagggccgggagcaggtggccagggcggcagccgccttcgcccgccgggtactcagcctggggcgagaggccgagatcctctccctggaaggggcgatcgcacagcggctcaggcagctgcagggctgcccctgggcaccaggcccggccccctgcctgctcccacagctggagctccatcctgggctcctggacaagaactgccaccttcttcggctgtcctttgaggagcagcagccccagaaggatggtgggaaagacggagctggtacccagggaggtgaggagagccagagccggagggaggatgagccgaagactgagagacagggtggagtccagccccaggccggagatggagcccagaccccaaaagaggaaaaagcccagacaacccgagaagagggagcccagaccttggaggaggacagggcccagacaccccacgaggatggaggaccccagccccacaggggtggcagacccaacaagaagaaaaagttcaaaggcaggctcaagtcaatttcccgggagcccagcccagccctggggccgaatctggacggctctggcctcctccccagacccatcttttactgcagtttccccacgcggatgcctggagacaagcggtccccccggatcaccgggctctgtcccttcggtccccgggagatcctggtggcggatgagcagaaccgggcactgaaacgcttctccctcaacggcgactacaagggcaccgtgccggtccctgagggctgctccccttgcagcgtggccgccctgcagagcgcggtggccttctccgctagcgcacggctctatctcatcaaccccaacggcgaagtgcagtggcgcagggccctgagcctctcccaggccagccacgcggtggcggcactgcctagcggggaccgcgtggctgtcagcgtggcgggccacgtggaggtgtacaatatggaaggcagcctggccacccggttcattcctggaggcaaggccagccggggcctgcgggcgctggtgtttctgaccaccagcccccaggggcatttcgtggggtcggactggcagcagaatagtgtggtaatctgtgatgggctgggccaggtggttggggagtacaaggggccaggcctgcatggctgccagccgggctccgtgtctgtggataagaagggctacatctttctgacccttcgagaagtcaacaaggtggtgatcctggacccgaaggggtccctccttggagacttcctgacagcctaccacggcctggaaaagccccgggttaccaccatggtggatggcaggtacctggtcgtgtccctcagtaacgggaccatccacatctttcgggtccgttctccggacagttaa
Sequence Length
2268
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
29,185 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 56, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 56
NCBI Official Symbol
TRIM56
NCBI Official Synonym Symbols
RNF109
NCBI Protein Information
E3 ubiquitin-protein ligase TRIM56
UniProt Protein Name
E3 ubiquitin-protein ligase TRIM56
Protein Family
UniProt Gene Name
TRIM56
UniProt Synonym Gene Names
RNF109
UniProt Entry Name
TRI56_HUMAN
Uniprot Description
TRIM56: E3 ubiquitin-protein ligase that mediates 'Lys-63'- linked polyubiquitination of TMEM173/STING, thereby playing a key role in innate immunity. TMEM173/STING 'Lys-63'-linked ubiquitination activates the production of type I interferon IFN- beta following detection of pathogen- and host-derived double- stranded DNA. Belongs to the TRIM/RBCC family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Ubiquitin conjugating system; RNA-binding; EC 6.3.2.-
Chromosomal Location of Human Ortholog: 7q22.1
Cellular Component: cytoplasm; cytosol
Molecular Function: ubiquitin-protein ligase activity
Biological Process: defense response to virus; interferon-beta production; regulation of interferon type I production
Research Articles on TRIM56
Similar Products
Product Notes
The TRIM56 trim56 (Catalog #AAA1278387) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtttccc acgggtcctc gccctccctc ctggaggccc tgagcagcga cttcctggcc tgtaaaatct gcctggagca gctgcgggca cccaagacac tgccctgcct gcatacctac tgccaagact gcctggcaca gctggcggat ggcggccgcg tccgctgccc cgagtgccgc gagacagtgc ctgtgccgcc cgagggtgtg gcctccttca agaccaactt cttcgtcaat gggctgctgg acctggtgaa ggcccgggcc tgtggagacc tgcgtgccgg gaagccagcc tgtgccctgt gtcccctggt gggtggcacc agcaccgggg ggccggccac ggcccggtgc ctggactgtg ccgatgactt gtgccaggcc tgtgccgacg ggcaccgctg cacccgccag acccacaccc accgcgtggt ggacctggtg ggctacaggg ccgggtggta tgatgaggag gcccgggagc gccaagcggc ccagtgtccc cagcaccccg gggaggcact gcgcttcctg tgccagccct gctcacagtt gctgtgcaga gagtgccgcc tagaccccca cctggaccac ccctgcctgc ctctggctga agctgtgcgt gcccggaggc cgggcctgga gggactgctg gccggtgtgg acaataacct ggtggagctg gaggcagcgc ggagggtgga gaaggaggcg ctagcccggc tgcgggagca ggcggcccgg gtggggactc aggtggagga ggcggctgag ggcgtcctcc gggccctgct ggcccagaag caggaggtgc tggggcagct acgagcccac gtggaggctg ccgaagaagc tgctcgggag aggctggcgg agcttgaggg ccgggagcag gtggccaggg cggcagccgc cttcgcccgc cgggtactca gcctggggcg agaggccgag atcctctccc tggaaggggc gatcgcacag cggctcaggc agctgcaggg ctgcccctgg gcaccaggcc cggccccctg cctgctccca cagctggagc tccatcctgg gctcctggac aagaactgcc accttcttcg gctgtccttt gaggagcagc agccccagaa ggatggtggg aaagacggag ctggtaccca gggaggtgag gagagccaga gccggaggga ggatgagccg aagactgaga gacagggtgg agtccagccc caggccggag atggagccca gaccccaaaa gaggaaaaag cccagacaac ccgagaagag ggagcccaga ccttggagga ggacagggcc cagacacccc acgaggatgg aggaccccag ccccacaggg gtggcagacc caacaagaag aaaaagttca aaggcaggct caagtcaatt tcccgggagc ccagcccagc cctggggccg aatctggacg gctctggcct cctccccaga cccatctttt actgcagttt ccccacgcgg atgcctggag acaagcggtc cccccggatc accgggctct gtcccttcgg tccccgggag atcctggtgg cggatgagca gaaccgggca ctgaaacgct tctccctcaa cggcgactac aagggcaccg tgccggtccc tgagggctgc tccccttgca gcgtggccgc cctgcagagc gcggtggcct tctccgctag cgcacggctc tatctcatca accccaacgg cgaagtgcag tggcgcaggg ccctgagcct ctcccaggcc agccacgcgg tggcggcact gcctagcggg gaccgcgtgg ctgtcagcgt ggcgggccac gtggaggtgt acaatatgga aggcagcctg gccacccggt tcattcctgg aggcaaggcc agccggggcc tgcgggcgct ggtgtttctg accaccagcc cccaggggca tttcgtgggg tcggactggc agcagaatag tgtggtaatc tgtgatgggc tgggccaggt ggttggggag tacaaggggc caggcctgca tggctgccag ccgggctccg tgtctgtgga taagaagggc tacatctttc tgacccttcg agaagtcaac aaggtggtga tcctggaccc gaaggggtcc ctccttggag acttcctgac agcctaccac ggcctggaaa agccccgggt taccaccatg gtggatggca ggtacctggt cgtgtccctc agtaacggga ccatccacat ctttcgggtc cgttctccgg acagttaa. It is sometimes possible for the material contained within the vial of "TRIM56, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
