TRIM52 cdna clone
TRIM52 cDNA Clone
Gene Names
TRIM52; RNF102
Synonyms
TRIM52; TRIM52 cDNA Clone; TRIM52 cdna clone
Sequence
atggctggttatgccactactcccagccccatgcagacccttcaggaggaagcggtgtgtgccatctgcttggattacttcaaggaccccgtgtccatcagctgtgggcacaacttctgccgagggtgtgtgacccagctgtggagtaaggaggacgaggaggaccagaacgaggaggaagatgaatgggaggaggaggaggacgaggaagcggtgggggccatggatggatgggacggctccattcgagaggtgttgtatcgggggaatgctgacgaagagttgttccaagaccaagatgacgatgaactctggctcggtgacagtggtataactaattgggacaacgtagactatatgtgggacgaggaggaagaagaagaagaggaagatcaggactattacctaggaggcttgagacctgacctgagaattgatgtctaccgagaagaagaaatactggaagcatacgatgaggacgaagatgaagagctgtatcctgacatccacccgcctccttccttgccccttccagggcagttcacctgcccccagtgccgaaagagctttacacgtcgcagctttcgtcccaacttgcagctggccaacatggtccagataattcgccagatgtgccccactccttatcggggaaaccggagtaatgatcagggcatgtgctttaaacaccaggaagccctgaaactcttctgtgaggtggacaaagaggccatctgtgtggtgtgccgagaatccaggagccacaaacagcacagcgtgctgcctttggaggaggtggtgcaggagtaccaggaaataaagttggaaacaactctggtgggaatacttcagatagagcaagaaagcattcacagcaaggcctataatcagtaa
Sequence Length
894
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
34,653 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 52, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 52
NCBI Official Symbol
TRIM52
NCBI Official Synonym Symbols
RNF102
NCBI Protein Information
tripartite motif-containing protein 52
UniProt Protein Name
Tripartite motif-containing protein 52
Protein Family
UniProt Gene Name
TRIM52
UniProt Synonym Gene Names
RNF102
UniProt Entry Name
TRI52_HUMAN
Uniprot Description
TRIM52: Belongs to the TRIM/RBCC family.
Protein type: Ubiquitin conjugating system
Chromosomal Location of Human Ortholog: 5q35.3
Biological Process: activation of NF-kappaB transcription factor
Similar Products
Product Notes
The TRIM52 trim52 (Catalog #AAA1270867) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctggtt atgccactac tcccagcccc atgcagaccc ttcaggagga agcggtgtgt gccatctgct tggattactt caaggacccc gtgtccatca gctgtgggca caacttctgc cgagggtgtg tgacccagct gtggagtaag gaggacgagg aggaccagaa cgaggaggaa gatgaatggg aggaggagga ggacgaggaa gcggtggggg ccatggatgg atgggacggc tccattcgag aggtgttgta tcgggggaat gctgacgaag agttgttcca agaccaagat gacgatgaac tctggctcgg tgacagtggt ataactaatt gggacaacgt agactatatg tgggacgagg aggaagaaga agaagaggaa gatcaggact attacctagg aggcttgaga cctgacctga gaattgatgt ctaccgagaa gaagaaatac tggaagcata cgatgaggac gaagatgaag agctgtatcc tgacatccac ccgcctcctt ccttgcccct tccagggcag ttcacctgcc cccagtgccg aaagagcttt acacgtcgca gctttcgtcc caacttgcag ctggccaaca tggtccagat aattcgccag atgtgcccca ctccttatcg gggaaaccgg agtaatgatc agggcatgtg ctttaaacac caggaagccc tgaaactctt ctgtgaggtg gacaaagagg ccatctgtgt ggtgtgccga gaatccagga gccacaaaca gcacagcgtg ctgcctttgg aggaggtggt gcaggagtac caggaaataa agttggaaac aactctggtg ggaatacttc agatagagca agaaagcatt cacagcaagg cctataatca gtaa. It is sometimes possible for the material contained within the vial of "TRIM52, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
