TRIM49 cdna clone
TRIM49 cDNA Clone
Gene Names
TRIM49; RNF18; TRIM49A; TRIM49L2
Synonyms
TRIM49; TRIM49 cDNA Clone; TRIM49 cdna clone
Sequence
atgaattctggaatcttacaggtctttcagggggaactcatctgccccctgtgcatgaactacttcatagacccggtcaccatagactgtgggcacagcttttgcaggccttgtttctacctcaactggcaagacatcccatttcttgtccagtgctctgaatgcacaaagtcaaccgagcagataaacctcaaaaccaacattcatttgaagaagatggcttctcttgccagaaaagtcagtctctggctattcctgagctctgaggagcaaatgtgtggcactcacagggagacaaagaagatattctgtgaagtggacaggagcctgctctgtttgctgtgctccagctctcaggagcaccggtatcacagacaccgtcccattgagtgggctgctgaggaacaccgggagaagcttttacagaaaatgcagtctttgtgggaaaaagcttgtgaaaatcacagaaacctgaatgtggaaaccaccagaaccagatgctggaaggattatgtgaatttaaggctagaagcaattagagctgagtatcagaagatgcctgcatttcatcatgaagaagaaaaacataatttggagatgctgaaaaagaaggggaaagaaatttttcatcgacttcatttaagtaaagccaaaatggctcataggatggagattttaagaggaatgtatgaggagctgaacgaaatgtgccataaaccagatgtggagctacttcaggcttttggagacatattacacaggagtgagtccgtgctgctgcacatgccccagcctctgaatccagagctcagtgcagggcccatcactggactgagggacaggctcaaccaattccgagtgcatattactctgcatcatgaagaagccaacaatgatatctttctgtatgaaattttgagaagcatgtgtattggatgtgaccatcaagatgtaccctatttcactgcaacacctagaagttttcttgcatggggtgttcagactttcacctcgggcaaatattactgggaggtccatgtaggggactcctggaattgggcttttggtgtctgtaatatgtatcggaaagagaagaatcagaatgagaagatagatggaaaggcgggactctttcttcttgggtgtgttaagaatgacattcaatgcagtctctttaccacctccccacttatgctgcaatatatcccaaaacctaccagccgagtaggattattcctggattgtgaggctaagactgtgagctttgttgatgttaatcaaagctccctaatatacaccatccctaattgctctttctcacctcctctcaggcctatcttttgctgtattcacttctga
Sequence Length
1359
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
52,888 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 49, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 49
NCBI Official Symbol
TRIM49
NCBI Official Synonym Symbols
RNF18; TRIM49A; TRIM49L2
NCBI Protein Information
tripartite motif-containing protein 49
UniProt Protein Name
Tripartite motif-containing protein 49
Protein Family
UniProt Gene Name
TRIM49
UniProt Synonym Gene Names
RNF18
UniProt Entry Name
TRI49_HUMAN
NCBI Description
The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This gene has been found to be preferentially expressed in testis. Related pseudogenes and gene duplicates have also been identified on chromosome 11. [provided by RefSeq, Aug 2010]
Uniprot Description
TRIM49: contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This gene has been found to be preferentially expressed in testis. Related pseudogenes and gene duplicates have also been identified on chromosome 11. [provided by RefSeq, Aug 2010]
Protein type: Ubiquitin conjugating system
Chromosomal Location of Human Ortholog: 11p11.12-q12
Molecular Function: protein binding; protein kinase binding
Similar Products
Product Notes
The TRIM49 trim49 (Catalog #AAA1273819) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaattctg gaatcttaca ggtctttcag ggggaactca tctgccccct gtgcatgaac tacttcatag acccggtcac catagactgt gggcacagct tttgcaggcc ttgtttctac ctcaactggc aagacatccc atttcttgtc cagtgctctg aatgcacaaa gtcaaccgag cagataaacc tcaaaaccaa cattcatttg aagaagatgg cttctcttgc cagaaaagtc agtctctggc tattcctgag ctctgaggag caaatgtgtg gcactcacag ggagacaaag aagatattct gtgaagtgga caggagcctg ctctgtttgc tgtgctccag ctctcaggag caccggtatc acagacaccg tcccattgag tgggctgctg aggaacaccg ggagaagctt ttacagaaaa tgcagtcttt gtgggaaaaa gcttgtgaaa atcacagaaa cctgaatgtg gaaaccacca gaaccagatg ctggaaggat tatgtgaatt taaggctaga agcaattaga gctgagtatc agaagatgcc tgcatttcat catgaagaag aaaaacataa tttggagatg ctgaaaaaga aggggaaaga aatttttcat cgacttcatt taagtaaagc caaaatggct cataggatgg agattttaag aggaatgtat gaggagctga acgaaatgtg ccataaacca gatgtggagc tacttcaggc ttttggagac atattacaca ggagtgagtc cgtgctgctg cacatgcccc agcctctgaa tccagagctc agtgcagggc ccatcactgg actgagggac aggctcaacc aattccgagt gcatattact ctgcatcatg aagaagccaa caatgatatc tttctgtatg aaattttgag aagcatgtgt attggatgtg accatcaaga tgtaccctat ttcactgcaa cacctagaag ttttcttgca tggggtgttc agactttcac ctcgggcaaa tattactggg aggtccatgt aggggactcc tggaattggg cttttggtgt ctgtaatatg tatcggaaag agaagaatca gaatgagaag atagatggaa aggcgggact ctttcttctt gggtgtgtta agaatgacat tcaatgcagt ctctttacca cctccccact tatgctgcaa tatatcccaa aacctaccag ccgagtagga ttattcctgg attgtgaggc taagactgtg agctttgttg atgttaatca aagctcccta atatacacca tccctaattg ctctttctca cctcctctca ggcctatctt ttgctgtatt cacttctga. It is sometimes possible for the material contained within the vial of "TRIM49, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
