Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIM38 cdna clone

TRIM38 cDNA Clone

Gene Names
TRIM38; RNF15; RORET
Synonyms
TRIM38; TRIM38 cDNA Clone; TRIM38 cdna clone
Ordering
For Research Use Only!
Sequence
atggcctcaaccaccagcaccaagaagatgatggaggaagccacctgctccatctgcctgagcctgatcacgaacccagtaagcatcaactgtggacacagctactgccacttgtgtataacagacttctttaaaaacccaagccaaaagcaactgaggcaggagacattctgctgtccccagtgtcgggctccatttcatatggatagcctccgacccaacaagcagctgggaagcctcattgaagccctcaaagagacggatcaagaaatgtcatgtgaggaacacggagagcagttccacctgttctgcgaagacgaggggcagctcatctgctggcgctgtgagcgggcaccacagcacaaagggcacaccacagctcttgttgaagacgtatgccagggctacaaggaaaagctccagaaagctgtgacaaaactgaagcaacttgaagacagatgtacggagcagaagctgtccacagcaatgcgaataactaaatggaaagagaaggtacagattcagagacaaaaaatccggtctgactttaagaatctccagtgtttcctacatgaggaagagaagtcttatctctggaggctggagaaagaagaacaacagactctgagtagactgagggactatgaggctggtctggggctgaagagcaatgaactcaagagccacatcctggaactggaggaaaaatgtcagggctcagcccagaaattgctgcagaatgtgaatgacactttgagcaggagttgggctgtgaagctggaaacatcagaggctgtctccttggaacttcatactatgtgcaatgtttccaagctttacttcgatgtgaagaaaatgttaaggagtcatcaagttagtgtgactctggatccagatacagctcatcacgaactaattctctctgaggatcggagacaagtgactcgtggatacacccaggagaatcaggacacatcttccaggagatttactgccttcccctgtgtcttgggttgtgaaggcttcacctcaggaagacgttactttgaagtggatgttggcgaaggaaccggatgggatttaggagtttgtatggaaaatgtgcagaggggcactggcatgaagcaagagcctcagtctggattctggaccctcaggctgtgcaaaaagaaaggctatgtagcacttacttctcccccaacttcccttcatctgcatgagcagcccctgcttgtgggaatttttctggactatgaggccggagttgtatccttttataacgggaatactggctgccacatctttactttcccgaaggcttccttctctgatactctccggccctatttccaggtttatcaatattctcctttgtttctgcctcccccaggtgactaa
Sequence Length
1398
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,416 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 38, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 38
NCBI Official Symbol
TRIM38
NCBI Official Synonym Symbols
RNF15; RORET
NCBI Protein Information
E3 ubiquitin-protein ligase TRIM38
UniProt Protein Name
E3 ubiquitin-protein ligase TRIM38
UniProt Gene Name
TRIM38
UniProt Synonym Gene Names
RNF15; RORET
UniProt Entry Name
TRI38_HUMAN

NCBI Description

This gene encodes a member of the tripartite motif (TRIM) family. The encoded protein contains a RING-type zinc finger, B box-type zinc finger and SPRY domain. The function of this protein has not been identified. A pseudogene of this gene is located on the long arm of chromosome 4. [provided by RefSeq, Jul 2012]

Uniprot Description

TRIM38: E3 ubiquitin-protein ligase. Mediates 'Lys-48'-linked polyubiquitination and proteasomal degradation of the critical TLR adapter TICAM1, inhibiting TLR3-mediated type I interferon signaling. {ECO:0000269|PubMed:23056470}

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 6p21.3

Cellular Component: cytosol

Molecular Function: protein binding; signal transducer activity

Biological Process: activation of NF-kappaB transcription factor; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of transcription factor activity; positive regulation of virion penetration into host cell

Research Articles on TRIM38

Similar Products

Product Notes

The TRIM38 trim38 (Catalog #AAA1277858) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcctcaa ccaccagcac caagaagatg atggaggaag ccacctgctc catctgcctg agcctgatca cgaacccagt aagcatcaac tgtggacaca gctactgcca cttgtgtata acagacttct ttaaaaaccc aagccaaaag caactgaggc aggagacatt ctgctgtccc cagtgtcggg ctccatttca tatggatagc ctccgaccca acaagcagct gggaagcctc attgaagccc tcaaagagac ggatcaagaa atgtcatgtg aggaacacgg agagcagttc cacctgttct gcgaagacga ggggcagctc atctgctggc gctgtgagcg ggcaccacag cacaaagggc acaccacagc tcttgttgaa gacgtatgcc agggctacaa ggaaaagctc cagaaagctg tgacaaaact gaagcaactt gaagacagat gtacggagca gaagctgtcc acagcaatgc gaataactaa atggaaagag aaggtacaga ttcagagaca aaaaatccgg tctgacttta agaatctcca gtgtttccta catgaggaag agaagtctta tctctggagg ctggagaaag aagaacaaca gactctgagt agactgaggg actatgaggc tggtctgggg ctgaagagca atgaactcaa gagccacatc ctggaactgg aggaaaaatg tcagggctca gcccagaaat tgctgcagaa tgtgaatgac actttgagca ggagttgggc tgtgaagctg gaaacatcag aggctgtctc cttggaactt catactatgt gcaatgtttc caagctttac ttcgatgtga agaaaatgtt aaggagtcat caagttagtg tgactctgga tccagataca gctcatcacg aactaattct ctctgaggat cggagacaag tgactcgtgg atacacccag gagaatcagg acacatcttc caggagattt actgccttcc cctgtgtctt gggttgtgaa ggcttcacct caggaagacg ttactttgaa gtggatgttg gcgaaggaac cggatgggat ttaggagttt gtatggaaaa tgtgcagagg ggcactggca tgaagcaaga gcctcagtct ggattctgga ccctcaggct gtgcaaaaag aaaggctatg tagcacttac ttctccccca acttcccttc atctgcatga gcagcccctg cttgtgggaa tttttctgga ctatgaggcc ggagttgtat ccttttataa cgggaatact ggctgccaca tctttacttt cccgaaggct tccttctctg atactctccg gccctatttc caggtttatc aatattctcc tttgtttctg cctcccccag gtgactaa. It is sometimes possible for the material contained within the vial of "TRIM38, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.