Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIM32 cdna clone

TRIM32 cDNA Clone

Gene Names
TRIM32; HT2A; BBS11; TATIP; LGMD2H
Synonyms
TRIM32; TRIM32 cDNA Clone; TRIM32 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgcagcagcagcttctcacctgaacctggatgccctccgggaagtgctagaatgccccatctgcatggagtccttcacagaagagcagctgcgtcccaagcttctgcactgtggccataccatctgccgccagtgcctggagaagctattggccagtagcatcaatggtgtccgctgtcccttttgcagcaagattacccgcataaccagcttgacccagctgacagacaatctgacagtgctaaagatcattgatacagctgggctcagcgaggctgtggggctgctcatgtgtcggtcctgtgggcggcgtctgccccggcaattctgccggagctgtggtttggtgttatgtgagccctgccgggaggcagaccatcagcctcctggccactgtacactccctgtcaaagaagcagctgaggagcggcgtcgggactttggagagaagttaactcgtctgcgggaacttatgggggagctgcagcggcggaaggcagccttggaaggtgtctccaaggaccttcaggcaaggtataaagcagttctccaggagtatgggcatgaggagcgcagggtccaggatgagctggctcgctctcggaagttcttcacaggctctttggctgaagttgagaagtccaatagtcaagtggtagaggagcagagttacctgcttaacattgcagaggtgcaggctgtgtctcgctgtgactacttcctggccaagatcaagcaggcagatgtagcactactggaggagacagctgatgaggaggagccagagctcactgccagcttgcctcgggagctcaccctgcaagatgtggagctccttaaggtaggtcatgttggccccctccaaattggacaagctgttaagaagccccggacagttaacgtggaagattcctgggccatggaggccacagcgtctgctgcctctacctctgttacttttagagagatggacatgagcccggaggaagtggttgccagccctagggcctcacctgctaaacagcggggtcctgaggcagcctccaatatccagcagtgcctctttctcaagaagatgggggccaaaggcagcactccaggaatgttcaatcttccagtcagtctctacgtgaccagtcaaggtgaagtactagtcgctgaccgtggtaactatcgtatacaagtctttacccgcaaaggctttttgaaggaaatccgccgcagccccagtggcattgatagctttgtgctaagcttccttggggcagatctacccaacctcactcctctctcagtggcaatgaactgccaggggctgattggtgtgactgacagctatgataactccctcaaggtatataccttggatggccactgcgtggcctgtcacaggagccagctgagcaaaccatggggtatcacagccttgccatctggccagtttgtagtaaccgatgtggaaggtggaaagctttggtgtttcacagttgatcgaggatcaggggtggtcaaatacagctgcctatgtagtgctgtgcggcccaaatttgtcacctgtgatgctgagggcaccgtctacttcacccagggcttaggcctcaatctggagaatcggcagaatgagcaccacctggagggtggcttttccattggctctgtaggccctgatgggcagctgggtcgccagattagccacttcttctcggagaatgaggatttccgctgcattgctggcatgtgtgtggatgctcgtggtgatctcatcgtggctgacagtagtcgcaaggaaattctccattttcctaagggtgggggctatagtgtccttattcgagagggacttacctgtccggtgggcatagccctaactcctaaggggcagctgctggtcttggactgttgggatcattgcatcaagatctacagctaccatctgagaagatattccaccccatag
Sequence Length
1962
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
71,989 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 32, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 32
NCBI Official Symbol
TRIM32
NCBI Official Synonym Symbols
HT2A; BBS11; TATIP; LGMD2H
NCBI Protein Information
E3 ubiquitin-protein ligase TRIM32
UniProt Protein Name
E3 ubiquitin-protein ligase TRIM32
UniProt Gene Name
TRIM32
UniProt Synonym Gene Names
HT2A
UniProt Entry Name
TRI32_HUMAN

NCBI Description

The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. The protein has also been localized to the nucleus, where it interacts with the activation domain of the HIV-1 Tat protein. The Tat protein activates transcription of HIV-1 genes. [provided by RefSeq, Jul 2008]

Uniprot Description

TRIM32: Has an E3 ubiquitin ligase activity. Ubiquitinates DTNBP1 (dysbindin) and promotes its degradation. May play a significant role in mediating the biological activity of the HIV-1 Tat protein in vivo. Binds specifically to the activation domain of HIV-1 Tat and can also interact with the HIV-2 and EIAV Tat proteins in vivo. Defects in TRIM32 are the cause of limb-girdle muscular dystrophy type 2H (LGMD2H); also known as muscular dystrophy Hutterite type. LGMD2H is an autosomal recessive degenerative myopathy characterized by pelvic girdle, shoulder girdle and quadriceps muscle weakness. Clinical phenotype and severity are highly variable. Disease progression is slow and most patients remain ambulatory into the sixth decade of life. Defects in TRIM32 are the cause of Bardet-Biedl syndrome type 11 (BBS11). Bardet-Biedl syndrome (BBS) is a genetically heterogeneous, autosomal recessive disorder characterized by usually severe pigmentary retinopathy, early onset obesity, polydactyly, hypogenitalism, renal malformation and mental retardation. Secondary features include diabetes mellitus, hypertension and congenital heart disease. A relatively high incidence of BBS is found in the mixed Arab populations of Kuwait and in Bedouin tribes throughout the Middle East, most likely due to the high rate of consaguinity in these populations and a founder effect. Belongs to the TRIM/RBCC family.

Protein type: EC 6.3.2.-; EC 6.3.2.19; Ligase; Ubiquitin conjugating system; Ubiquitin ligase

Chromosomal Location of Human Ortholog: 9q33.1

Cellular Component: cytoplasm; cytosol; nucleus; striated muscle thick filament

Molecular Function: identical protein binding; myosin binding; protein binding; protein self-association; RNA binding; Tat protein binding; transcription coactivator activity; translation initiation factor binding; ubiquitin binding; ubiquitin-protein ligase activity

Biological Process: activation of NF-kappaB transcription factor; fat cell differentiation; innate immune response; negative regulation of fibroblast proliferation; negative regulation of viral transcription; positive regulation of cell cycle; positive regulation of cell growth; positive regulation of cell migration; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of neurogenesis; positive regulation of neuron differentiation; positive regulation of protein catabolic process; positive regulation of proteolysis; positive regulation of transcription factor activity; protein polyubiquitination; protein ubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process; regulation of interferon type I production; response to UV

Disease: Bardet-biedl Syndrome 11; Muscular Dystrophy, Limb-girdle, Type 2h

Research Articles on TRIM32

Similar Products

Product Notes

The TRIM32 trim32 (Catalog #AAA1271549) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcag cagcagcttc tcacctgaac ctggatgccc tccgggaagt gctagaatgc cccatctgca tggagtcctt cacagaagag cagctgcgtc ccaagcttct gcactgtggc cataccatct gccgccagtg cctggagaag ctattggcca gtagcatcaa tggtgtccgc tgtccctttt gcagcaagat tacccgcata accagcttga cccagctgac agacaatctg acagtgctaa agatcattga tacagctggg ctcagcgagg ctgtggggct gctcatgtgt cggtcctgtg ggcggcgtct gccccggcaa ttctgccgga gctgtggttt ggtgttatgt gagccctgcc gggaggcaga ccatcagcct cctggccact gtacactccc tgtcaaagaa gcagctgagg agcggcgtcg ggactttgga gagaagttaa ctcgtctgcg ggaacttatg ggggagctgc agcggcggaa ggcagccttg gaaggtgtct ccaaggacct tcaggcaagg tataaagcag ttctccagga gtatgggcat gaggagcgca gggtccagga tgagctggct cgctctcgga agttcttcac aggctctttg gctgaagttg agaagtccaa tagtcaagtg gtagaggagc agagttacct gcttaacatt gcagaggtgc aggctgtgtc tcgctgtgac tacttcctgg ccaagatcaa gcaggcagat gtagcactac tggaggagac agctgatgag gaggagccag agctcactgc cagcttgcct cgggagctca ccctgcaaga tgtggagctc cttaaggtag gtcatgttgg ccccctccaa attggacaag ctgttaagaa gccccggaca gttaacgtgg aagattcctg ggccatggag gccacagcgt ctgctgcctc tacctctgtt acttttagag agatggacat gagcccggag gaagtggttg ccagccctag ggcctcacct gctaaacagc ggggtcctga ggcagcctcc aatatccagc agtgcctctt tctcaagaag atgggggcca aaggcagcac tccaggaatg ttcaatcttc cagtcagtct ctacgtgacc agtcaaggtg aagtactagt cgctgaccgt ggtaactatc gtatacaagt ctttacccgc aaaggctttt tgaaggaaat ccgccgcagc cccagtggca ttgatagctt tgtgctaagc ttccttgggg cagatctacc caacctcact cctctctcag tggcaatgaa ctgccagggg ctgattggtg tgactgacag ctatgataac tccctcaagg tatatacctt ggatggccac tgcgtggcct gtcacaggag ccagctgagc aaaccatggg gtatcacagc cttgccatct ggccagtttg tagtaaccga tgtggaaggt ggaaagcttt ggtgtttcac agttgatcga ggatcagggg tggtcaaata cagctgccta tgtagtgctg tgcggcccaa atttgtcacc tgtgatgctg agggcaccgt ctacttcacc cagggcttag gcctcaatct ggagaatcgg cagaatgagc accacctgga gggtggcttt tccattggct ctgtaggccc tgatgggcag ctgggtcgcc agattagcca cttcttctcg gagaatgagg atttccgctg cattgctggc atgtgtgtgg atgctcgtgg tgatctcatc gtggctgaca gtagtcgcaa ggaaattctc cattttccta agggtggggg ctatagtgtc cttattcgag agggacttac ctgtccggtg ggcatagccc taactcctaa ggggcagctg ctggtcttgg actgttggga tcattgcatc aagatctaca gctaccatct gagaagatat tccaccccat ag. It is sometimes possible for the material contained within the vial of "TRIM32, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.