Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIM26 cdna clone

TRIM26 cDNA Clone

Gene Names
TRIM26; AFP; RNF95; ZNF173
Synonyms
TRIM26; TRIM26 cDNA Clone; TRIM26 cdna clone
Ordering
For Research Use Only!
Sequence
atggccacgtcagccccactacggagcctggaagaggaggtgacctgctccatctgtcttgattacctgcgggaccctgtgaccattgactgtggccacgtcttctgccgcagctgcaccacagacgtccgccccatctcagggagccgccccgtctgcccactctgcaagaagccttttaagaaggagaacatccgacccgtgtggcaactggccagcctggtggagaacattgagcggctgaaggtggacaagggcaggcagccgggagaggtgacccgggagcagcaggatgcaaagttgtgcgagcgacaccgagagaagctgcactactactgtgaggacgacgggaagctgctgtgcgtgatgtgccgggagtcccgggagcacaggccccacacggccgtcctcatggagaaggccgcccagccccacagggaaaaaatcctgaaccacctgagtaccctaaggagggacagagacaaaattcagggcttccaggcaaagggagaagctgatatcctggccgcgctgaagaagctccaggaccagaggcagtacattgtggctgagtttgagcagggtcatcagttcctgagggagcgggaggaacacctgctggaacagctggcgaagctggagcaggagctcacggagggcagggagaagttcaagagccggggcgtcggggagcttgcccggctggccctggtcatctccgaactggagggcaaggcgcagcagccagctgcagagctcatgcaggacacgagagacttcctaaacaggtatccacggaagaagttctgggttgggaaacccattgctcgagtggttaaaaaaaagaccggagaattctcagataaactcctctctctgcaacgaggcctgagggaattccaggggaagctgctgagagacttggaatataagacagtgagcgtcaccctggacccacagtcggccagtgggtacctgcagctgtcagaggactggaagtgcgtgacctacaccagcctgtacaagagtgcctacctgcacccccagcagtttgactgtgagcctggggtgctaggcagcaagggcttcacctggggcaaggtctactgggaagtggaagtggagagggagggctggtctgaggatgaagaagagggggatgaggaggaagagggagaagaggaggaggaggaagaggaggccggctatggggatggatatgacgactgggaaacggacgaagatgaggaatcgttgggcgatgaagaggaagaagaggaggaggaagaggaggaagttctggaaagctgcatggtgggggtggctagagactctgtgaagaggaagggagacctctccctgcggccagaggatggcgtgtgggcgctgcgcctctcctcctccggcatctgggccaacaccagccccgaggctgagcttttcccagcactgcggccccggagagtgggcatcgccctggattatgaagggggcaccgtgactttcaccaacgcagagtcacaggaactcatctacaccttcactgccaccttcacccggcgcctggtccccttcctgtggctcaagtggccaggaacacgcctcctgctaagaccctga
Sequence Length
1620
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
62,166 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 26, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 26
NCBI Official Symbol
TRIM26
NCBI Official Synonym Symbols
AFP; RNF95; ZNF173
NCBI Protein Information
tripartite motif-containing protein 26
UniProt Protein Name
Tripartite motif-containing protein 26
UniProt Gene Name
TRIM26
UniProt Synonym Gene Names
RNF95; ZNF173; AFP
UniProt Entry Name
TRI26_HUMAN

NCBI Description

The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Although the function of the protein is unknown, the RING domain suggests that the protein may have DNA-binding activity. The gene localizes to the major histocompatibility complex (MHC) class I region on chromosome 6. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2011]

Uniprot Description

TRIM26: is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Although the function of the protein is unknown, the RING domain suggests that the protein may have DNA-binding activity. The gene localizes to the major histocompatibility complex (MHC) class I region on chromosome 6. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2011]

Protein type: DNA-binding; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 6p21.3

Cellular Component: cytosol

Molecular Function: protein binding

Biological Process: innate immune response; negative regulation of virion penetration into host cell; positive regulation of transcription factor activity

Research Articles on TRIM26

Similar Products

Product Notes

The TRIM26 trim26 (Catalog #AAA1272508) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccacgt cagccccact acggagcctg gaagaggagg tgacctgctc catctgtctt gattacctgc gggaccctgt gaccattgac tgtggccacg tcttctgccg cagctgcacc acagacgtcc gccccatctc agggagccgc cccgtctgcc cactctgcaa gaagcctttt aagaaggaga acatccgacc cgtgtggcaa ctggccagcc tggtggagaa cattgagcgg ctgaaggtgg acaagggcag gcagccggga gaggtgaccc gggagcagca ggatgcaaag ttgtgcgagc gacaccgaga gaagctgcac tactactgtg aggacgacgg gaagctgctg tgcgtgatgt gccgggagtc ccgggagcac aggccccaca cggccgtcct catggagaag gccgcccagc cccacaggga aaaaatcctg aaccacctga gtaccctaag gagggacaga gacaaaattc agggcttcca ggcaaaggga gaagctgata tcctggccgc gctgaagaag ctccaggacc agaggcagta cattgtggct gagtttgagc agggtcatca gttcctgagg gagcgggagg aacacctgct ggaacagctg gcgaagctgg agcaggagct cacggagggc agggagaagt tcaagagccg gggcgtcggg gagcttgccc ggctggccct ggtcatctcc gaactggagg gcaaggcgca gcagccagct gcagagctca tgcaggacac gagagacttc ctaaacaggt atccacggaa gaagttctgg gttgggaaac ccattgctcg agtggttaaa aaaaagaccg gagaattctc agataaactc ctctctctgc aacgaggcct gagggaattc caggggaagc tgctgagaga cttggaatat aagacagtga gcgtcaccct ggacccacag tcggccagtg ggtacctgca gctgtcagag gactggaagt gcgtgaccta caccagcctg tacaagagtg cctacctgca cccccagcag tttgactgtg agcctggggt gctaggcagc aagggcttca cctggggcaa ggtctactgg gaagtggaag tggagaggga gggctggtct gaggatgaag aagaggggga tgaggaggaa gagggagaag aggaggagga ggaagaggag gccggctatg gggatggata tgacgactgg gaaacggacg aagatgagga atcgttgggc gatgaagagg aagaagagga ggaggaagag gaggaagttc tggaaagctg catggtgggg gtggctagag actctgtgaa gaggaaggga gacctctccc tgcggccaga ggatggcgtg tgggcgctgc gcctctcctc ctccggcatc tgggccaaca ccagccccga ggctgagctt ttcccagcac tgcggccccg gagagtgggc atcgccctgg attatgaagg gggcaccgtg actttcacca acgcagagtc acaggaactc atctacacct tcactgccac cttcacccgg cgcctggtcc ccttcctgtg gctcaagtgg ccaggaacac gcctcctgct aagaccctga. It is sometimes possible for the material contained within the vial of "TRIM26, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.