Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIB3 cdna clone

TRIB3 cDNA Clone

Gene Names
TRIB3; NIPK; SINK; TRB3; SKIP3; C20orf97
Synonyms
TRIB3; TRIB3 cDNA Clone; TRIB3 cdna clone
Ordering
For Research Use Only!
Sequence
atgcgagccacccctctggctgctcctgcgggttccctgtccaggaagaagcggttggagttggatgacaacttagataccgagcgtcccgtccagaaacgagctcgaagtgggccccagcccagactgcccccctgcctgttgcccctgagcccacctactgctccagatcgtgcaactgctgtggccactgcctcccgtcttgggccctatgtcctcctggagcccgaggagggcgggcgggcctaccaggccctgcactgccctacaggcactgagtatacctgcaaggtgtaccccgtccaggaagccctggccgtgctggagccctatgcgcggctgcccccgcacaagcatgtggctcggcccactgaggtcctggctggtacccagctcctctacgcctttttcactcggacccatggggacatgcacagcctggtgcgaagccgccaccgtatccctgagcctgaggctgccgtgctcttccgccagatggccaccgccctggcgcactgtcaccagcacggtctggtcctgcgtgatctcaagctgtgtcgctttgtcttcgctgaccgtgagaggaagaagctggtgctggagaacctggaggactcctgcgtgctgactgggccagatgattccctgtgggacaagcacgcgtgcccagcctacgtgggacctgagatactcagctcacgggcctcatactcgggcaaggcagccgatgtctggagcctgggcgtggcgctcttcaccatgctggccggccactaccccttccaggactcggagcctgtcctgctcttcggcaagatccgccgcggggcctacgccttgcctgcaggcctctcggcccctgcccgctgtctggttcgctgcctccttcgtcgggagccagctgaacggctcacagccacaggcatcctcctgcacccctggctgcgacaggacccgatgcccttagccccaacccgatcccatctctgggaggctgcccaggtggtccctgatggactggggctggacgaagccagggaagaggagggagacagagaagtggttctgtatggctag
Sequence Length
1077
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,578 Da
NCBI Official Full Name
Homo sapiens tribbles homolog 3 (Drosophila), mRNA
NCBI Official Synonym Full Names
tribbles pseudokinase 3
NCBI Official Symbol
TRIB3
NCBI Official Synonym Symbols
NIPK; SINK; TRB3; SKIP3; C20orf97
NCBI Protein Information
tribbles homolog 3
UniProt Protein Name
Tribbles homolog 3
Protein Family
UniProt Gene Name
TRIB3
UniProt Synonym Gene Names
C20orf97; NIPK; SKIP3; TRB3; TRB-3
UniProt Entry Name
TRIB3_HUMAN

NCBI Description

The protein encoded by this gene is a putative protein kinase that is induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. Differential promoter usage and alternate splicing result in multiple transcript variants. [provided by RefSeq, Jul 2014]

Uniprot Description

TRB3: a Ca(2)/calmodulin-dependent protein kinase of the Trbl family. Induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. May negatively regulate the cell survival kinase AKT1.

Protein type: Kinase, protein; Protein kinase, Ser/Thr (non-receptor); Protein kinase, CAMK; CAMK group; Trbl family

Chromosomal Location of Human Ortholog: 20p13-p12.2

Cellular Component: cytosol; nucleoplasm; nucleus; plasma membrane

Molecular Function: kinase activity; mitogen-activated protein kinase kinase binding; protein binding; protein kinase binding; transcription corepressor activity; ubiquitin protein ligase binding; ubiquitin-protein ligase regulator activity

Biological Process: cellular response to insulin stimulus; negative regulation of fat cell differentiation; negative regulation of fatty acid biosynthetic process; negative regulation of protein kinase activity; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; positive regulation of proteasomal ubiquitin-dependent protein catabolic process; positive regulation of protein binding; positive regulation of ubiquitin-protein ligase activity; regulation of MAP kinase activity

Research Articles on TRIB3

Similar Products

Product Notes

The TRIB3 trib3 (Catalog #AAA1265727) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgagcca cccctctggc tgctcctgcg ggttccctgt ccaggaagaa gcggttggag ttggatgaca acttagatac cgagcgtccc gtccagaaac gagctcgaag tgggccccag cccagactgc ccccctgcct gttgcccctg agcccaccta ctgctccaga tcgtgcaact gctgtggcca ctgcctcccg tcttgggccc tatgtcctcc tggagcccga ggagggcggg cgggcctacc aggccctgca ctgccctaca ggcactgagt atacctgcaa ggtgtacccc gtccaggaag ccctggccgt gctggagccc tatgcgcggc tgcccccgca caagcatgtg gctcggccca ctgaggtcct ggctggtacc cagctcctct acgccttttt cactcggacc catggggaca tgcacagcct ggtgcgaagc cgccaccgta tccctgagcc tgaggctgcc gtgctcttcc gccagatggc caccgccctg gcgcactgtc accagcacgg tctggtcctg cgtgatctca agctgtgtcg ctttgtcttc gctgaccgtg agaggaagaa gctggtgctg gagaacctgg aggactcctg cgtgctgact gggccagatg attccctgtg ggacaagcac gcgtgcccag cctacgtggg acctgagata ctcagctcac gggcctcata ctcgggcaag gcagccgatg tctggagcct gggcgtggcg ctcttcacca tgctggccgg ccactacccc ttccaggact cggagcctgt cctgctcttc ggcaagatcc gccgcggggc ctacgccttg cctgcaggcc tctcggcccc tgcccgctgt ctggttcgct gcctccttcg tcgggagcca gctgaacggc tcacagccac aggcatcctc ctgcacccct ggctgcgaca ggacccgatg cccttagccc caacccgatc ccatctctgg gaggctgccc aggtggtccc tgatggactg gggctggacg aagccaggga agaggaggga gacagagaag tggttctgta tggctag. It is sometimes possible for the material contained within the vial of "TRIB3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.