TRAIP cdna clone
TRAIP cDNA Clone
Gene Names
TRAIP; TRIP; SCKL9; RNF206
Synonyms
TRAIP; TRAIP cDNA Clone; TRAIP cdna clone
Sequence
atgcctatccgtgctctgtgcactatctgctccgacttcttcgatcactcccgcgacgtggccgccatccactgcggccacaccttccacttgcagtgcctaattcagtggtttgagacagcaccaagtcggacctgcccacagtgccgaatccaggttggcaaaagaaccattatcaataagctcttctttgatcttgcccaggaggaggagaatgtcttggatgcagaattcttaaagaatgaactggacaatgtcagagcccagctttcccagaaagacaaggagaaacgagacagccaggtcatcatcgacactctgcgggatacgctggaagaacgcaatgctactgtggtatctctgcagcaggccttgggcaaggccgagatgctgtgctccacactgaaaaagcagatgaagtacttagagcagcagcaggatgagaccaaacaagcacaagaggaggcccgccggctcaggagcaagatgaagaccatggagcagattgagcttctactccagagccagcgccctgaggtggaggagatgatccgagacatgggtgtgggacagtcagcggtggaacagctggctgtgtactgtgtgtctctcaagaaagagtacgagaatctaaaagaggcacggaaggcctcaggggaggtggctgacaagctgaggaaggatttgttttcctccagaagcaagttgcagacagtctactctgaattggatcaggccaagttagaactgaagtcagcccagaaggacttacagagtgctgacaaggaaatcatgagcctgaaaaagaagctaacgatgctgcaggaaaccttgaacctgccaccagtggccagtgagactgtcgaccgcctggttttagagagcccagcccctgtggaggtgaatctgaagctccgccggccatccttccgtgatgatattgatctcaatgctacctttgatgtggatactcccccagcccggccctccagctcccagcatggttactacgaaaaactttgcctagagaagtcacactccccaattcaggatgtccccaagaagatatgcaaaggccccaggaaggagtcccagctctcactgggtggccagagctgtgcaggagagccagatgaggaactggttggtgccttccctatttttgtccggaatgccatcctaggccagaaacagcccaagaggcccaggtcagagtcctcttgcagcaaagatgtggtaaggacaggcttcgatgggctcggtggccggacaaaattcatccagcctactgacacagtcatgatccgcccattgcctgttaagcccaagaccaaggttaagcagagggtgagggtgaagacagtgccttctctcttccaggccaagctggacaccttcctgtggtcgtga
Sequence Length
1410
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
53,294 Da
NCBI Official Full Name
Homo sapiens TRAF interacting protein, mRNA
NCBI Official Synonym Full Names
TRAF interacting protein
NCBI Official Symbol
TRAIP
NCBI Official Synonym Symbols
TRIP; SCKL9; RNF206
NCBI Protein Information
E3 ubiquitin-protein ligase TRAIP
UniProt Protein Name
E3 ubiquitin-protein ligase TRAIP
Protein Family
UniProt Gene Name
TRAIP
UniProt Synonym Gene Names
RNF206; TRIP
UniProt Entry Name
TRAIP_HUMAN
NCBI Description
This gene encodes a protein that contains an N-terminal RING finger motif and a putative coiled-coil domain. A similar murine protein interacts with TNFR-associated factor 1 (TRAF1), TNFR-associated factor 2 (TRAF2), and cylindromatosis. The interaction with TRAF2 inhibits TRAF2-mediated nuclear factor kappa-B, subunit 1 activation that is required for cell activation and protection against apoptosis. [provided by RefSeq, Jul 2008]
Uniprot Description
TRAIP: Inhibits activation of NF-kappa-B mediated by TNF.
Protein type: EC 6.3.2.-; Ubiquitin ligase; Ubiquitin conjugating system; Nucleolus; Ligase
Chromosomal Location of Human Ortholog: 3p21.31
Molecular Function: protein binding
Biological Process: apoptosis; cell proliferation; signal transduction
Disease: Seckel Syndrome 9
Research Articles on TRAIP
Similar Products
Product Notes
The TRAIP traip (Catalog #AAA1275597) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctatcc gtgctctgtg cactatctgc tccgacttct tcgatcactc ccgcgacgtg gccgccatcc actgcggcca caccttccac ttgcagtgcc taattcagtg gtttgagaca gcaccaagtc ggacctgccc acagtgccga atccaggttg gcaaaagaac cattatcaat aagctcttct ttgatcttgc ccaggaggag gagaatgtct tggatgcaga attcttaaag aatgaactgg acaatgtcag agcccagctt tcccagaaag acaaggagaa acgagacagc caggtcatca tcgacactct gcgggatacg ctggaagaac gcaatgctac tgtggtatct ctgcagcagg ccttgggcaa ggccgagatg ctgtgctcca cactgaaaaa gcagatgaag tacttagagc agcagcagga tgagaccaaa caagcacaag aggaggcccg ccggctcagg agcaagatga agaccatgga gcagattgag cttctactcc agagccagcg ccctgaggtg gaggagatga tccgagacat gggtgtggga cagtcagcgg tggaacagct ggctgtgtac tgtgtgtctc tcaagaaaga gtacgagaat ctaaaagagg cacggaaggc ctcaggggag gtggctgaca agctgaggaa ggatttgttt tcctccagaa gcaagttgca gacagtctac tctgaattgg atcaggccaa gttagaactg aagtcagccc agaaggactt acagagtgct gacaaggaaa tcatgagcct gaaaaagaag ctaacgatgc tgcaggaaac cttgaacctg ccaccagtgg ccagtgagac tgtcgaccgc ctggttttag agagcccagc ccctgtggag gtgaatctga agctccgccg gccatccttc cgtgatgata ttgatctcaa tgctaccttt gatgtggata ctcccccagc ccggccctcc agctcccagc atggttacta cgaaaaactt tgcctagaga agtcacactc cccaattcag gatgtcccca agaagatatg caaaggcccc aggaaggagt cccagctctc actgggtggc cagagctgtg caggagagcc agatgaggaa ctggttggtg ccttccctat ttttgtccgg aatgccatcc taggccagaa acagcccaag aggcccaggt cagagtcctc ttgcagcaaa gatgtggtaa ggacaggctt cgatgggctc ggtggccgga caaaattcat ccagcctact gacacagtca tgatccgccc attgcctgtt aagcccaaga ccaaggttaa gcagagggtg agggtgaaga cagtgccttc tctcttccag gccaagctgg acaccttcct gtggtcgtga. It is sometimes possible for the material contained within the vial of "TRAIP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
