Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRAF4 cdna clone

TRAF4 cDNA Clone

Gene Names
TRAF4; CART1; MLN62; RNF83
Synonyms
TRAF4; TRAF4 cDNA Clone; TRAF4 cdna clone
Ordering
For Research Use Only!
Sequence
atgcctggcttcgactacaagttcctggagaagcccaagcgacggctgctgtgcccactgtgcgggaagcccatgcgcgagcctgtgcaggtttccacctgcggccaccgtttctgcgatacctgcctgcaggagttcctcagtgaaggagtcttcaagtgccctgaggaccagcttcctctggactatgccaagatctacccagacccggagctggaagtacaagtattgggcctgcctatccgctgcatccacagtgaggagggctgccgctggagtgggccactacgtcatctacagggccacctgaatacctgcagcttcaatgtcattccctgccctaatcgctgccccatgaagctgagccgccgtgatctacctgcacacttgcagcatgactgccccaagcggcgcctcaagtgcgagttttgtggctgtgacttcagtggggaggcctatgagagccatgagggtatgtgcccccaggagagtgtctactgtgagaataagtgtggtgcccgcatgatgcggcggctgctggcccagcatgccacctctgagtgccccaagcgcactcagccctgcacctactgcactaaggagttcgtctttgacaccatccagagccaccagtaccagtgcccaaggctgcctgttgcctgccccaaccaatgtggtgtgggcactgtggctcgggaggacctgccaggccatctgaaggacagctgtaacaccgccctggtgctctgcccattcaaagactccggctgcaagcacaggtgccctaagctggcaatggcacggcatgtggaggagagtgtgaagccacatctggccatgatgtgtgccctggtgagccggcaacggcaggagctgcaggagcttcggcgagagctggaggagctatcagtgggcagtgatggcgtgctcatctggaagattggcagctatggacggcggctacaggaggccaaggccaagcccaaccttgagtgcttcagcccagccttctacacacataagtatggttacaagctgcaggtgtctgcattcctcaatggcaatggcagtggtgagggcacacacctctcactgtacattcgtgtgctgcctggtgcctttgacaatctccttgagtggccctttgcccgccgtgtcaccttctccctgctggatcagagcgaccctgggctggctaaaccacagcacgtcactgagaccttccaccccgacccaaactggaagaatttccagaagccaggcacgtggcggggctccctggatgagagttctctgggctttggttatcccaagttcatctcccaccaggacattcgaaagcgaaactatgtgcgggatgatgcagtcttcatccgtgctgctgttgaactgccccggaagatcctcagctga
Sequence Length
1413
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,841 Da
NCBI Official Full Name
Homo sapiens TNF receptor-associated factor 4, mRNA
NCBI Official Synonym Full Names
TNF receptor associated factor 4
NCBI Official Symbol
TRAF4
NCBI Official Synonym Symbols
CART1; MLN62; RNF83
NCBI Protein Information
TNF receptor-associated factor 4
UniProt Protein Name
TNF receptor-associated factor 4
UniProt Gene Name
TRAF4
UniProt Synonym Gene Names
CART1; MLN62; RNF83; MLN 62
UniProt Entry Name
TRAF4_HUMAN

NCBI Description

This gene encodes a member of the TNF receptor associated factor (TRAF) family. TRAF proteins are associated with, and mediate signal transduction from members of the TNF receptor superfamily. The encoded protein has been shown to interact with neurotrophin receptor, p75 (NTR/NTSR1), and negatively regulate NTR induced cell death and NF-kappa B activation. This protein has been found to bind to p47phox, a cytosolic regulatory factor included in a multi-protein complex known as NAD(P)H oxidase. This protein thus, is thought to be involved in the oxidative activation of MAPK8/JNK. Alternatively spliced transcript variants have been observed but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

TRAF4: Adapter protein and signal transducer that links members of the tumor necrosis factor receptor (TNFR) family to different signaling pathways. Plays a role in the activation of NF-kappa-B and JNK, and in the regulation of cell survival and apoptosis. Regulates activation of NF-kappa-B in response to signaling through Toll-like receptors. Required for normal skeleton development, and for normal development of the respiratory tract. Required for activation of RPS6KB1 in response to TNF signaling. Modulates TRAF6 functions. Belongs to the TNF receptor-associated factor family. B subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding; Adaptor/scaffold

Chromosomal Location of Human Ortholog: 17q11-q12

Cellular Component: cytoplasm; nucleus

Molecular Function: DNA binding; identical protein binding; protein binding; thioesterase binding; tumor necrosis factor receptor binding; ubiquitin protein ligase binding; WW domain binding

Biological Process: positive regulation of JNK cascade; positive regulation of protein kinase activity; signal transduction

Research Articles on TRAF4

Similar Products

Product Notes

The TRAF4 traf4 (Catalog #AAA1276295) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctggct tcgactacaa gttcctggag aagcccaagc gacggctgct gtgcccactg tgcgggaagc ccatgcgcga gcctgtgcag gtttccacct gcggccaccg tttctgcgat acctgcctgc aggagttcct cagtgaagga gtcttcaagt gccctgagga ccagcttcct ctggactatg ccaagatcta cccagacccg gagctggaag tacaagtatt gggcctgcct atccgctgca tccacagtga ggagggctgc cgctggagtg ggccactacg tcatctacag ggccacctga atacctgcag cttcaatgtc attccctgcc ctaatcgctg ccccatgaag ctgagccgcc gtgatctacc tgcacacttg cagcatgact gccccaagcg gcgcctcaag tgcgagtttt gtggctgtga cttcagtggg gaggcctatg agagccatga gggtatgtgc ccccaggaga gtgtctactg tgagaataag tgtggtgccc gcatgatgcg gcggctgctg gcccagcatg ccacctctga gtgccccaag cgcactcagc cctgcaccta ctgcactaag gagttcgtct ttgacaccat ccagagccac cagtaccagt gcccaaggct gcctgttgcc tgccccaacc aatgtggtgt gggcactgtg gctcgggagg acctgccagg ccatctgaag gacagctgta acaccgccct ggtgctctgc ccattcaaag actccggctg caagcacagg tgccctaagc tggcaatggc acggcatgtg gaggagagtg tgaagccaca tctggccatg atgtgtgccc tggtgagccg gcaacggcag gagctgcagg agcttcggcg agagctggag gagctatcag tgggcagtga tggcgtgctc atctggaaga ttggcagcta tggacggcgg ctacaggagg ccaaggccaa gcccaacctt gagtgcttca gcccagcctt ctacacacat aagtatggtt acaagctgca ggtgtctgca ttcctcaatg gcaatggcag tggtgagggc acacacctct cactgtacat tcgtgtgctg cctggtgcct ttgacaatct ccttgagtgg ccctttgccc gccgtgtcac cttctccctg ctggatcaga gcgaccctgg gctggctaaa ccacagcacg tcactgagac cttccacccc gacccaaact ggaagaattt ccagaagcca ggcacgtggc ggggctccct ggatgagagt tctctgggct ttggttatcc caagttcatc tcccaccagg acattcgaaa gcgaaactat gtgcgggatg atgcagtctt catccgtgct gctgttgaac tgccccggaa gatcctcagc tga. It is sometimes possible for the material contained within the vial of "TRAF4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.