Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRAF2 cdna clone

TRAF2 cDNA Clone

Gene Names
TRAF2; TRAP; TRAP3; MGC:45012
Synonyms
TRAF2; TRAF2 cDNA Clone; TRAF2 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgcagctagcgtgaccccccctggctccctggagttgctacagcccggcttctccaagaccctcctggggaccaagctggaagccaagtacctgtgctccgcctgcagaaacgtcctccgcaggcccttccaggcgcagtgtggccaccggtactgctccttctgcctggccagcatcctcagctctgggcctcagaactgtgctgcctgtgttcacgagggcatatatgaagaaggcatttctattttagaaagcagttcggccttcccagataatgctgcccgcagggaggtggagagcctgccggccgtctgtcccagtgatggatgcacctggaaggggaccctgaaagaatacgagagctgccacgaaggccgctgcccgctcatgctgaccgaatgtcccgcgtgcaaaggcctggtccgccttggtgaaaaggagcgccacctggagcacgagtgcccggagagaagcctgagctgccggcattgccgggcaccctgctgcggagcagacgtgaaggcgcaccacgaggtctgccccaagttccccttaacttgtgacggctgcggcaagaagaagatcccccgggagaagtttcaggaccacgtcaagacttgtggcaagtgtcgagtcccttgcagattccacgccatcggctgcctcgagacggtagagggtgagaaacagcaggagcacgaggtgcagtggctgcgggagcacctggccatgctactgagctcggtgctggaggcaaagcccctcttgggagaccagagccacgcggggtcagagctcctgcagaggtgcgagagcctggagaagaagacggccacttttgagaacattgtctgcgtcctgaaccgggaggtggagagggtggccatgactgccgaggcctgcagccggcagcaccggctggaccaagacaagattgaagccctgagtagcaaggtgcagcagctggagaggagcattggcctcaaggacctggcgatggctgacttggagcagaaggtcttggagatggaggcatccacctacgatggggtcttcatctggaagatctcagacttcgccaggaagcgccaggaagctgtggctggccgcatacccgccatcttctccccagccttctacaccagcaggtacggctacaagatgtgtctgcgtatctacctgaacggcgacggcaccgggcgaggaacacacctgtccctcttctttgtggtgatgaagggcccgaatgacgccctgctgcggtggcccttcaaccagaaggtgaccttaatgctgctcgaccagaataaccgggagcacgtgattgacgccttcaggcccgacgtgacttcatcctcttttcagaggccagtcaacgacatgaacatcgcaagcggctgccccctcttctgccccgtctccaagatggaggcaaagaattcctacgtgcgggacgatgccatcttcatcaaggccattgtggacctgacagggctctaa
Sequence Length
1506
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,055 Da
NCBI Official Full Name
Homo sapiens TNF receptor-associated factor 2, mRNA
NCBI Official Synonym Full Names
TNF receptor associated factor 2
NCBI Official Symbol
TRAF2
NCBI Official Synonym Symbols
TRAP; TRAP3; MGC:45012
NCBI Protein Information
TNF receptor-associated factor 2
UniProt Protein Name
TNF receptor-associated factor 2
UniProt Gene Name
TRAF2
UniProt Synonym Gene Names
TRAP3
UniProt Entry Name
TRAF2_HUMAN

NCBI Description

The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from members of the TNF receptor superfamily. This protein directly interacts with TNF receptors, and forms a heterodimeric complex with TRAF1. This protein is required for TNF-alpha-mediated activation of MAPK8/JNK and NF-kappaB. The protein complex formed by this protein and TRAF1 interacts with the inhibitor-of-apoptosis proteins (IAPs), and functions as a mediator of the anti-apoptotic signals from TNF receptors. The interaction of this protein with TRADD, a TNF receptor associated apoptotic signal transducer, ensures the recruitment of IAPs for the direct inhibition of caspase activation. BIRC2/c-IAP1, an apoptosis inhibitor possessing ubiquitin ligase activity, can unbiquitinate and induce the degradation of this protein, and thus potentiate TNF-induced apoptosis. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of only one transcript has been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

TRAF2: Regulates activation of NF-kappa-B and JNK and plays a central role in the regulation of cell survival and apoptosis. Required for normal antibody isotype switching from IgM to IgG. Has E3 ubiquitin-protein ligase activity and promotes 'Lys-63'- linked ubiquitination of target proteins, such as BIRC3, RIPK1 and TICAM1. Is an essential constituent of several E3 ubiquitin- protein ligase complexes, where it promotes the ubiquitination of target proteins by bringing them into contact with other E3 ubiquitin ligases. Regulates BIRC2 and BIRC3 protein levels by inhibiting their autoubiquitination and subsequent degradation; this does not depend on the TRAF2 RING-type zinc finger domain. Homotrimer, and heterotrimer with TRAF1 and TRAF3 (via TRAF domain). The domain containing the RING-type and the first TRAF-type zinc finger can also form homodimers (in vitro). Interacts with TNFRSF1B/TNFR2, TNFRSF4, TNFRSF5/CD40, CD27/TNFRSF7, TNFRSF8/CD30, TNFRSF9/CD137, TNFRSF11A/RANK, TNFRSF13B/TACI, TNFRSF14, TNFRSF16/NGFR, TNFRSF17/BCMA, TNFRSF18/AITR, TNFRSF19/TROY, TNFRSF19L/RELT, XEDAR, EDAR, Epstein-Barr virus BNFL1/LMP-1 and IL15RA. Interacts with CDK9, CSK, MAP3K1, MAP3K5, MAP3K11, MAP3K14, MAP4K2, RIPK1, RIPK2, TNIK, TBK1, SPHK1, TRADD, TRAFD1, TRAIP, TANK/ITRAF, TNFAIP3, TDP2, MAVS/IPS1, TICAM1 and TRPC4AP. Interacts with CASP8AP2, NFATC2IP, PEG3 and HIVEP3. Interacts with BIRC2 and BIRC3 N- terminus; a single BIRC2 or BIRC3 molecule interacts with a heterotrimer formed by TRAF1 and TRAF2, or a TRAF2 homotrimer. Identified in a complex composed of TRAF2, TRAF3, BIRC2 and BIRC3. Interaction with BIRC2 and/or BIRC3 is essential for degradation of NFKBIA and activation of NF-kappa-B. Interacts with CYLD, USP48, DAB2IP, IKKA and IKKB. Identified in a complex with TNFRSF1A, RIPK1 and IKKB. Interacts (via 'Lys-63'-linked polyubiquitin chains) with TAB2 and TAB3. Interacts with ERN1 and TAOK3. Interaction with TAOK3 is facilitated under ER stress conditions, such as treatment with tunicamycin, and may promote TRAF2 phosphorylation. Has very low E3 ubiquitin ligase activity in the absence of sphingosine-1-phosphate. E3 ubiquitin ligase activity is strongly activated by cytoplasmic sphingosine-1- phosphate. Belongs to the TNF receptor-associated factor family. A subfamily. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.2.-; Autophagy; Ligase; Ubiquitin conjugating system; Ubiquitin ligase

Chromosomal Location of Human Ortholog: 9q34

Cellular Component: cytoplasm; cytosol; internal side of plasma membrane; ubiquitin ligase complex

Molecular Function: CD40 receptor binding; enzyme binding; identical protein binding; protein binding; protein kinase binding; protein phosphatase binding; sphingolipid binding; thioesterase binding; tumor necrosis factor receptor binding; ubiquitin protein ligase binding; ubiquitin-protein ligase activity

Biological Process: activation of NF-kappaB transcription factor; activation of NF-kappaB-inducing kinase; caspase activation; cellular protein complex assembly; I-kappaB kinase/NF-kappaB cascade; positive regulation of interleukin-2 production; positive regulation of JNK activity; positive regulation of T cell activation; positive regulation of T cell cytokine production; positive regulation of transcription factor activity; protein autoubiquitination; protein complex assembly; regulation of apoptosis; signal transduction; tumor necrosis factor-mediated signaling pathway

Research Articles on TRAF2

Similar Products

Product Notes

The TRAF2 traf2 (Catalog #AAA1268411) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcag ctagcgtgac cccccctggc tccctggagt tgctacagcc cggcttctcc aagaccctcc tggggaccaa gctggaagcc aagtacctgt gctccgcctg cagaaacgtc ctccgcaggc ccttccaggc gcagtgtggc caccggtact gctccttctg cctggccagc atcctcagct ctgggcctca gaactgtgct gcctgtgttc acgagggcat atatgaagaa ggcatttcta ttttagaaag cagttcggcc ttcccagata atgctgcccg cagggaggtg gagagcctgc cggccgtctg tcccagtgat ggatgcacct ggaaggggac cctgaaagaa tacgagagct gccacgaagg ccgctgcccg ctcatgctga ccgaatgtcc cgcgtgcaaa ggcctggtcc gccttggtga aaaggagcgc cacctggagc acgagtgccc ggagagaagc ctgagctgcc ggcattgccg ggcaccctgc tgcggagcag acgtgaaggc gcaccacgag gtctgcccca agttcccctt aacttgtgac ggctgcggca agaagaagat cccccgggag aagtttcagg accacgtcaa gacttgtggc aagtgtcgag tcccttgcag attccacgcc atcggctgcc tcgagacggt agagggtgag aaacagcagg agcacgaggt gcagtggctg cgggagcacc tggccatgct actgagctcg gtgctggagg caaagcccct cttgggagac cagagccacg cggggtcaga gctcctgcag aggtgcgaga gcctggagaa gaagacggcc acttttgaga acattgtctg cgtcctgaac cgggaggtgg agagggtggc catgactgcc gaggcctgca gccggcagca ccggctggac caagacaaga ttgaagccct gagtagcaag gtgcagcagc tggagaggag cattggcctc aaggacctgg cgatggctga cttggagcag aaggtcttgg agatggaggc atccacctac gatggggtct tcatctggaa gatctcagac ttcgccagga agcgccagga agctgtggct ggccgcatac ccgccatctt ctccccagcc ttctacacca gcaggtacgg ctacaagatg tgtctgcgta tctacctgaa cggcgacggc accgggcgag gaacacacct gtccctcttc tttgtggtga tgaagggccc gaatgacgcc ctgctgcggt ggcccttcaa ccagaaggtg accttaatgc tgctcgacca gaataaccgg gagcacgtga ttgacgcctt caggcccgac gtgacttcat cctcttttca gaggccagtc aacgacatga acatcgcaag cggctgcccc ctcttctgcc ccgtctccaa gatggaggca aagaattcct acgtgcggga cgatgccatc ttcatcaagg ccattgtgga cctgacaggg ctctaa. It is sometimes possible for the material contained within the vial of "TRAF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.