TRABD cdna clone
TRABD cDNA Clone
Gene Names
TRABD; LP6054; PP2447
Synonyms
TRABD; TRABD cDNA Clone; TRABD cdna clone
Sequence
atggacggggaggagcagcagccaccgcacgaggccaacgtggaacctgttgtgccgtcagaggcttcagagccggtgcccagggtgtacgtggtggggacagcccacttcagcgacgacagcaagagggacgttgtgaagaccatccgggaggtgcagcctgacgtggtggtcgtggagctctgccaatatcgtgtgtccatgctgaagatggacgagagcacgctgctgcgggaggcccaggagctcagcctggagaagctgcagcaggccgtgaggcagaacgggctcatgtcggggctgatgcagatgctgctgctgaaggtgtctgcacacatcaccgagcagctgggcatggccccaggtggcgagttcagggaggccttcaaggaggccagcaaggtgcctttctgcaagttccacctgggtgaccgacccatccccgtcaccttcaagagggccatcgcagcgctctccttctggcagaaggtcaggctggcttggggcctgtgcttcctgtcagaccccatcagcaaggatgacgtggaacgctgcaagcagaaggacctactggagcagatgatggccgagatgattggcgagttcccagacctgcaccgcaccatcgtctcggagcgcgacgtctacctaacctacatgctgcgccaggccgcgcggcgcctcgagctgcctcgggcctctgacgccgagcccaggaagtgcgtcccctccgtggtcgtgggcgtcgtgggcatgggccacgtgcctggcatcgagaagaactggagcaccgacctcaacatccaggagatcatgaccgtgcccccgccgtccgtctccggcagagtgtctcggttggccgtgaaggccgccttcttcggcctgctgggctacagcctgtactggatgggccgccgcaccgcgagcctggtcctgtcgctgcccgccgcgcagtactgcctgcagagggtgaccgaggcccggcacaagtag
Sequence Length
993
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
37,091 Da
NCBI Official Full Name
Homo sapiens TraB domain containing, mRNA
NCBI Official Synonym Full Names
TraB domain containing
NCBI Official Symbol
TRABD
NCBI Official Synonym Symbols
LP6054; PP2447
NCBI Protein Information
traB domain-containing protein
UniProt Protein Name
TraB domain-containing protein
Protein Family
UniProt Gene Name
TRABD
UniProt Synonym Gene Names
TTG2
UniProt Entry Name
TRABD_HUMAN
Uniprot Description
TRABD: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 22q13.33
Similar Products
Product Notes
The TRABD trabd (Catalog #AAA1268639) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgggg aggagcagca gccaccgcac gaggccaacg tggaacctgt tgtgccgtca gaggcttcag agccggtgcc cagggtgtac gtggtgggga cagcccactt cagcgacgac agcaagaggg acgttgtgaa gaccatccgg gaggtgcagc ctgacgtggt ggtcgtggag ctctgccaat atcgtgtgtc catgctgaag atggacgaga gcacgctgct gcgggaggcc caggagctca gcctggagaa gctgcagcag gccgtgaggc agaacgggct catgtcgggg ctgatgcaga tgctgctgct gaaggtgtct gcacacatca ccgagcagct gggcatggcc ccaggtggcg agttcaggga ggccttcaag gaggccagca aggtgccttt ctgcaagttc cacctgggtg accgacccat ccccgtcacc ttcaagaggg ccatcgcagc gctctccttc tggcagaagg tcaggctggc ttggggcctg tgcttcctgt cagaccccat cagcaaggat gacgtggaac gctgcaagca gaaggaccta ctggagcaga tgatggccga gatgattggc gagttcccag acctgcaccg caccatcgtc tcggagcgcg acgtctacct aacctacatg ctgcgccagg ccgcgcggcg cctcgagctg cctcgggcct ctgacgccga gcccaggaag tgcgtcccct ccgtggtcgt gggcgtcgtg ggcatgggcc acgtgcctgg catcgagaag aactggagca ccgacctcaa catccaggag atcatgaccg tgcccccgcc gtccgtctcc ggcagagtgt ctcggttggc cgtgaaggcc gccttcttcg gcctgctggg ctacagcctg tactggatgg gccgccgcac cgcgagcctg gtcctgtcgc tgcccgccgc gcagtactgc ctgcagaggg tgaccgaggc ccggcacaag tag. It is sometimes possible for the material contained within the vial of "TRABD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
