Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TPM4 cdna clone

TPM4 cDNA Clone

Gene Names
TPM4; HEL-S-108
Synonyms
TPM4; TPM4 cDNA Clone; TPM4 cdna clone
Ordering
For Research Use Only!
Sequence
atggccggcctcaactccctggaggcggtgaaacgcaagatccaggccctgcagcagcaggcggacgaggcggaagaccgcgcgcagggcctgcagcgggagctggacggcgagcgcgagcggcgcgagaaagctgaaggtgatgtggccgccctcaaccgacgcatccagctctttgaggaggagttggacagggctcaggaacgactggccacggccctgcagaagctggaggaggcagaaaaagctgcagatgagagtgagagaggaatgaaggtgatagaaaaccgggccatgaaggatgaggagaagatggagattcaggagatgcagctcaaagaggccaagcacattgcggaagaggctgaccgcaaatacgaggaggtagctcgtaagctggtcatcctggagggtgagctggagagggcagaggagcgtgcggaggtgtctgaactaaaatgtggtgacctggaagaagaactcaagaatgttactaacaatctgaaatctctggaggctgcatctgaaaagtattctgaaaaggaggacaaatatgaagaagaaattaaacttctgtctgacaaactgaaagaggctgagacccgtgctgaatttgcagagagaacggttgcaaaactggaaaagacaattgatgacctggaagagaaacttgcccaggccaaagaagagaacgtgggcttacatcagacactggatcagacactaaacgaacttaactgtatataa
Sequence Length
747
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,723 Da
NCBI Official Full Name
Homo sapiens tropomyosin 4, mRNA
NCBI Official Synonym Full Names
tropomyosin 4
NCBI Official Symbol
TPM4
NCBI Official Synonym Symbols
HEL-S-108
NCBI Protein Information
tropomyosin alpha-4 chain
UniProt Protein Name
Tropomyosin alpha-4 chain
Protein Family
UniProt Gene Name
TPM4
UniProt Entry Name
TPM4_HUMAN

NCBI Description

This gene encodes a member of the tropomyosin family of actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. Tropomyosins are dimers of coiled-coil proteins that polymerize end-to-end along the major groove in most actin filaments. They provide stability to the filaments and regulate access of other actin-binding proteins. In muscle cells, they regulate muscle contraction by controlling the binding of myosin heads to the actin filament. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]

Uniprot Description

TPM4: a cytoskeletal protein that binds to actin filaments in muscle and nonmuscle cells. Plays a central role, in association with the troponin complex, in the calcium dependent regulation of vertebrate striated muscle contraction. Smooth muscle contraction is regulated by interaction with caldesmon. In nonmuscle cells is implicated in stabilizing cytoskeleton actin filaments and endocytosis.

Protein type: Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 19p13.1

Cellular Component: cytoskeleton; cytosol; focal adhesion; membrane; muscle thin filament tropomyosin; stress fiber

Molecular Function: protein binding; structural constituent of muscle

Biological Process: cell motility; muscle contraction; muscle filament sliding; osteoblast differentiation

Research Articles on TPM4

Similar Products

Product Notes

The TPM4 tpm4 (Catalog #AAA1278956) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccggcc tcaactccct ggaggcggtg aaacgcaaga tccaggccct gcagcagcag gcggacgagg cggaagaccg cgcgcagggc ctgcagcggg agctggacgg cgagcgcgag cggcgcgaga aagctgaagg tgatgtggcc gccctcaacc gacgcatcca gctctttgag gaggagttgg acagggctca ggaacgactg gccacggccc tgcagaagct ggaggaggca gaaaaagctg cagatgagag tgagagagga atgaaggtga tagaaaaccg ggccatgaag gatgaggaga agatggagat tcaggagatg cagctcaaag aggccaagca cattgcggaa gaggctgacc gcaaatacga ggaggtagct cgtaagctgg tcatcctgga gggtgagctg gagagggcag aggagcgtgc ggaggtgtct gaactaaaat gtggtgacct ggaagaagaa ctcaagaatg ttactaacaa tctgaaatct ctggaggctg catctgaaaa gtattctgaa aaggaggaca aatatgaaga agaaattaaa cttctgtctg acaaactgaa agaggctgag acccgtgctg aatttgcaga gagaacggtt gcaaaactgg aaaagacaat tgatgacctg gaagagaaac ttgcccaggc caaagaagag aacgtgggct tacatcagac actggatcag acactaaacg aacttaactg tatataa. It is sometimes possible for the material contained within the vial of "TPM4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.