Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TP53 cdna clone

TP53 cDNA Clone

Gene Names
TP53; P53; BCC7; LFS1; TRP53
Synonyms
TP53; TP53 cDNA Clone; TP53 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggagccgcagtcagatcctagcgtcgagccccctctgagtcaggaaacattttcagacctatggaaactacttcctgaaaacaacgttctgtcccccttgccgtcccaagcaatggatgatttgatgctgtccccggacgatattgaacaatggttcactgaagacccaggtccagatgaagctcccagaatgccagaggctgctccccgcgtggcccctgcaccagcagctcctacaccggcggcccctgcaccagccccctcctggcccctgtcatcttctgtcccttcccagaaaacctaccagggcagctacggtttccgtctgggcttcttgcattctgggacagccaagtctgtgacttgcacgtactcccctgccctcaacaagatgttttgccaactggccaagacctgccctgtgcagctgtgggttgattccacacccccgcccggcacccgcgtccgcgccatggccatctacaagcagtcacagcacatgacggaggttgtgaggcgctgcccccaccatgagcgctgctcagatagcgatggtctggcccctcctcagcatcttatccgagtggaaggaaatttgcgtgtggagtatttggatgacagaaacacttttcgacatagtgtggtggtgccctatgagccgcctgaggttggctctgactgtaccaccatccactacaactacatgtgtaacagttcctgcatgggcggcatgaaccggaggcccatcctcaccatcatcacactggaagactccagtggtaatctactgggacggaacagctttgaggtgcgtgtttgtgcctgtgctgggagagaccggcgcacagaggaagagaatctccgcaagaaaggggagcctcaccacgagctgcccccagggagcactaagcgagcactgcccaacaacaccagctcctctccccagccaaagaagaaaccactggatggagaatatttcacccttcagatccgtgggcgtgagcgcttcgagatgttccgagagctgaatgaggccttggaactcaaggatgcccaggctgggaaggagccaggggggagcagggctcactccagccacctgaagtccaaaaagggtcagtctacctcccgccataaaaaactcatgttcaagacagaagggcctgactcagactga
Sequence Length
1182
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,401 Da
NCBI Official Full Name
Homo sapiens tumor protein p53, mRNA
NCBI Official Synonym Full Names
tumor protein p53
NCBI Official Symbol
TP53
NCBI Official Synonym Symbols
P53; BCC7; LFS1; TRP53
NCBI Protein Information
cellular tumor antigen p53
UniProt Protein Name
Cellular tumor antigen p53
Protein Family
UniProt Gene Name
TP53
UniProt Synonym Gene Names
P53
UniProt Entry Name
P53_HUMAN

NCBI Description

This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons (PMIDs: 12032546, 20937277). [provided by RefSeq, Feb 2013]

Uniprot Description

p53: a transcription factor and major tumor suppressor that plays a major role in regulating cellular responses to DNA damage and other genomic aberrations. Activation of p53 can lead to either cell cycle arrest and DNA repair or apoptosis. More than 50 percent of human tumors contain a mutation or deletion of the TP53 gene. p53 is modified post-translationally at multiple sites. DNA damage induces phosphorylation of p53 at S15, S20 and S37, reducing its interaction with the oncoprotein MDM2. MDM2 inhibits p53 accumulation by targeting it for ubiquitination and proteasomal degradation. Phosphorylated by many kinases including Chk2 and Chk1 at S20, enhancing its tetramerization, stability and activity. The phosphorylation by CAK at S392 is increased in human tumors and has been reported to influence the growth suppressor function, DNA binding and transcriptional activation of p53. Phosphorylation of p53 at S46 regulates the ability of p53 to induce apoptosis. The acetylation of p53 appears to play a positive role in the accumulation of p53 during the stress response. Following DNA damage, p53 becomes acetylated at K382, enhancing its binding to DNA. Deacetylation of p53 can occur through interaction with SIRT1, a deacetylase that may be involved in cellular aging and the DNA damage response. p53 regulates the transcription of a set of genes encoding endosomal proteins that regulate endosomal functions. These include STEAP3 and CHMP4C, which enhance exosome production, and CAV1 and CHMP4C, which produce a more rapid endosomal clearance of the EGFR from the plasma membrane. DNA damage regulates a p53-mediated secretory pathway, increasing the secretion of some proteins such as Hsp90, SERPINE1, SERPINB5, NKEF-A, and CyPA, and inhibiting the secretion of others including CTSL and IGFBP-2. Two alternatively spliced human isoforms have been reported. Isoform 2 is expressed in quiescent lymphocytes. Seems to be non-functional. May be produced at very low levels due to a premature stop codon in the mRNA, leading to nonsense-mediated mRNA decay.

Protein type: Activator; DNA-binding; Tumor suppressor; Motility/polarity/chemotaxis; Nuclear receptor co-regulator; Transcription factor

Chromosomal Location of Human Ortholog: 17p13.1

Cellular Component: cytoplasm; cytosol; mitochondrion; nuclear body; nuclear chromatin; nuclear matrix; nucleolus; nucleoplasm; nucleus; PML body; protein complex; replication fork; transcription factor TFIID complex

Molecular Function: ATP binding; chaperone binding; chromatin binding; copper ion binding; damaged DNA binding; DNA binding; double-stranded DNA binding; enzyme binding; histone acetyltransferase binding; identical protein binding; p53 binding; protease binding; protein binding; protein heterodimerization activity; protein kinase binding; protein N-terminus binding; protein phosphatase 2A binding; protein phosphatase binding; protein self-association; receptor tyrosine kinase binding; sequence-specific DNA binding; transcription factor activity; transcription factor binding; ubiquitin protein ligase binding; zinc ion binding

Biological Process: base-excision repair; cell aging; cell cycle arrest; cell differentiation; cell proliferation; cellular response to glucose starvation; chromatin assembly; circadian behavior; determination of adult life span; DNA damage response, signal transduction by p53 class mediator; DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest; DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis; DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator; DNA strand renaturation; entrainment of circadian clock by photoperiod; ER overload response; G1 DNA damage checkpoint; multicellular organismal development; negative regulation of apoptosis; negative regulation of cell growth; negative regulation of cell proliferation; negative regulation of fibroblast proliferation; negative regulation of helicase activity; negative regulation of telomerase activity; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; nucleotide-excision repair; positive regulation of apoptosis; positive regulation of histone deacetylation; positive regulation of neuron apoptosis; positive regulation of peptidyl-tyrosine phosphorylation; positive regulation of protein export from nucleus; positive regulation of protein oligomerization; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; proteasomal ubiquitin-dependent protein catabolic process; protein complex assembly; protein localization; protein sumoylation; protein tetramerization; Ras protein signal transduction; regulation of apoptosis; regulation of mitochondrial membrane permeability; regulation of transcription, DNA-dependent; response to antibiotic; response to DNA damage stimulus; response to gamma radiation; response to X-ray; viral reproduction

Disease: Adrenocortical Carcinoma, Hereditary; Basal Cell Carcinoma, Susceptibility To, 7; Breast Cancer; Colorectal Cancer; Glioma Susceptibility 1; Hepatocellular Carcinoma; Li-fraumeni Syndrome 1; Nasopharyngeal Carcinoma; Osteogenic Sarcoma; Pancreatic Cancer; Papilloma Of Choroid Plexus

Research Articles on TP53

Similar Products

Product Notes

The TP53 tp53 (Catalog #AAA1278468) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggagc cgcagtcaga tcctagcgtc gagccccctc tgagtcagga aacattttca gacctatgga aactacttcc tgaaaacaac gttctgtccc ccttgccgtc ccaagcaatg gatgatttga tgctgtcccc ggacgatatt gaacaatggt tcactgaaga cccaggtcca gatgaagctc ccagaatgcc agaggctgct ccccgcgtgg cccctgcacc agcagctcct acaccggcgg cccctgcacc agccccctcc tggcccctgt catcttctgt cccttcccag aaaacctacc agggcagcta cggtttccgt ctgggcttct tgcattctgg gacagccaag tctgtgactt gcacgtactc ccctgccctc aacaagatgt tttgccaact ggccaagacc tgccctgtgc agctgtgggt tgattccaca cccccgcccg gcacccgcgt ccgcgccatg gccatctaca agcagtcaca gcacatgacg gaggttgtga ggcgctgccc ccaccatgag cgctgctcag atagcgatgg tctggcccct cctcagcatc ttatccgagt ggaaggaaat ttgcgtgtgg agtatttgga tgacagaaac acttttcgac atagtgtggt ggtgccctat gagccgcctg aggttggctc tgactgtacc accatccact acaactacat gtgtaacagt tcctgcatgg gcggcatgaa ccggaggccc atcctcacca tcatcacact ggaagactcc agtggtaatc tactgggacg gaacagcttt gaggtgcgtg tttgtgcctg tgctgggaga gaccggcgca cagaggaaga gaatctccgc aagaaagggg agcctcacca cgagctgccc ccagggagca ctaagcgagc actgcccaac aacaccagct cctctcccca gccaaagaag aaaccactgg atggagaata tttcaccctt cagatccgtg ggcgtgagcg cttcgagatg ttccgagagc tgaatgaggc cttggaactc aaggatgccc aggctgggaa ggagccaggg gggagcaggg ctcactccag ccacctgaag tccaaaaagg gtcagtctac ctcccgccat aaaaaactca tgttcaagac agaagggcct gactcagact ga. It is sometimes possible for the material contained within the vial of "TP53, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.