TOMM70A cdna clone
TOMM70A cDNA Clone
Gene Names
TOMM70; Tom70; TOMM70A
Synonyms
TOMM70A; TOMM70A cDNA Clone; TOMM70A cdna clone
Sequence
atggccgcctctaaacctgtggaggcagcggtggtcgcagccgctgtaccgagctccgggagtggggtgggcggcgggactgcgggcccgggcacgggggggctgccgcgatggcagctggctctggcggtcggggcacccctgctgctgggcgcgggtgccatatacctgtggagtcggcagcaacggcgccgggaggccagaggccggggcgacgccagcggcctgaagcgcaacagcgaacggaagaccccggagggcagggccagtccggccccgggcagcggacaccctgaaggtcccggtgctcacttggacatgaactctcttgatagagcccaagcagccaagaataaaggcaataaatattttaaagcaggaaaatatgaacaagctattcagtgctatactgaggctattagcttgtgccctacagagaagaatgttgacctttctacattttatcaaaacagagctgctgcctttgaacagttgcaaaaatggaaagaagtggcacaagactgtacaaaagctgttgaacttaatcccaaatatgtgaaagctctctttagacgtgcaaaagcccatgagaagctagacaataagaaggaatgtttagaagatgtcactgctgtgtgtatattagaagggttccaaaatcaacaaagcatgctgttagccgataaagttcttaaactccttggaaaagagaaagccaaagaaaaatataagaatcgtgaacctctgatgccatctccacagtttatcaaatcttacttcagttctttcacggatgatatcatttcccagcccatgcttaaaggagagaaatctgatgaagataaagacaaggaaggggaggctttagaagtgaaagaaaattctggatacttaaaggccaaacagtatatggaagaagaaaactacgataaaatcataagtgaatgctcaaaagaaatagatgctgaaggcaaatacatggcagaagcattgctactacgagctaccttctacctgcttattggcaatgccaatgcagccaaaccagatttagataaagtcatcagtttgaaagaagctaatgtgaagcttcgagcaaatgctctcatcaaaagaggcagcatgtacatgcaacagcagcagcctttgctgtccactcaagattttaacatggctgctgacatcgatcctcagaatgcagatgtttatcaccaccgaggacagctgaaaatactccttgatcaagttgaagaagcagtggcagattttgatgaatgtattaggttaagacctgagtctgctctggcacaagcacagaaatgttttgcattgtaccgccaggcatatacgggaaacaactcttcacaaatccaagcagctatgaaaggttttgaagaggtcataaagaaatttccaaggtgtgccgaaggctatgcactatacgcccaggcattaacagatcaacaacagtttggtaaagctgatgaaatgtatgataaatgtattgatttggaaccagataatgctacaacatatgttcataaaggtttacttcaacttcagtggaagcaagatctggatagaggtttggaacttatcagcaaggctattgaaattgacaataaatgtgattttgcctatgaaaccatgggaactattgaagtacaaagaggaaacatggagaaagccattgacatgttcaacaaagctattaacctggccaaatcggaaatggagatggcccatctgtattcactttgcgatgccgcccatgcccagacagaagttgcaaagaaatacggattaaaaccaccaacattataa
Sequence Length
1824
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
67,455 Da
NCBI Official Full Name
Homo sapiens translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
translocase of outer mitochondrial membrane 70
NCBI Official Symbol
TOMM70
NCBI Official Synonym Symbols
Tom70; TOMM70A
NCBI Protein Information
mitochondrial import receptor subunit TOM70
UniProt Protein Name
Mitochondrial import receptor subunit TOM70
UniProt Gene Name
TOMM70
UniProt Entry Name
TOM70_HUMAN
NCBI Description
This gene encodes an import receptor of the outer mitochondrial membrane that is part of the translocase of the outer membrane complex. This protein is involved in the import of mitochondrial precursor proteins. [provided by RefSeq, Oct 2011]
Uniprot Description
TOMM70A: Receptor that accelerates the import of all mitochondrial precursor proteins. Belongs to the Tom70 family.
Protein type: Mitochondrial; Receptor, protein translocating; Membrane protein, integral
Chromosomal Location of Human Ortholog: 3q12.2
Cellular Component: membrane; mitochondrial outer membrane; mitochondrial outer membrane translocase complex; mitochondrion
Molecular Function: protein binding; protein transmembrane transporter activity
Biological Process: macroautophagy; protein targeting to mitochondrion
Research Articles on TOMM70A
Similar Products
Product Notes
The TOMM70A tomm70 (Catalog #AAA1269266) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgcct ctaaacctgt ggaggcagcg gtggtcgcag ccgctgtacc gagctccggg agtggggtgg gcggcgggac tgcgggcccg ggcacggggg ggctgccgcg atggcagctg gctctggcgg tcggggcacc cctgctgctg ggcgcgggtg ccatatacct gtggagtcgg cagcaacggc gccgggaggc cagaggccgg ggcgacgcca gcggcctgaa gcgcaacagc gaacggaaga ccccggaggg cagggccagt ccggccccgg gcagcggaca ccctgaaggt cccggtgctc acttggacat gaactctctt gatagagccc aagcagccaa gaataaaggc aataaatatt ttaaagcagg aaaatatgaa caagctattc agtgctatac tgaggctatt agcttgtgcc ctacagagaa gaatgttgac ctttctacat tttatcaaaa cagagctgct gcctttgaac agttgcaaaa atggaaagaa gtggcacaag actgtacaaa agctgttgaa cttaatccca aatatgtgaa agctctcttt agacgtgcaa aagcccatga gaagctagac aataagaagg aatgtttaga agatgtcact gctgtgtgta tattagaagg gttccaaaat caacaaagca tgctgttagc cgataaagtt cttaaactcc ttggaaaaga gaaagccaaa gaaaaatata agaatcgtga acctctgatg ccatctccac agtttatcaa atcttacttc agttctttca cggatgatat catttcccag cccatgctta aaggagagaa atctgatgaa gataaagaca aggaagggga ggctttagaa gtgaaagaaa attctggata cttaaaggcc aaacagtata tggaagaaga aaactacgat aaaatcataa gtgaatgctc aaaagaaata gatgctgaag gcaaatacat ggcagaagca ttgctactac gagctacctt ctacctgctt attggcaatg ccaatgcagc caaaccagat ttagataaag tcatcagttt gaaagaagct aatgtgaagc ttcgagcaaa tgctctcatc aaaagaggca gcatgtacat gcaacagcag cagcctttgc tgtccactca agattttaac atggctgctg acatcgatcc tcagaatgca gatgtttatc accaccgagg acagctgaaa atactccttg atcaagttga agaagcagtg gcagattttg atgaatgtat taggttaaga cctgagtctg ctctggcaca agcacagaaa tgttttgcat tgtaccgcca ggcatatacg ggaaacaact cttcacaaat ccaagcagct atgaaaggtt ttgaagaggt cataaagaaa tttccaaggt gtgccgaagg ctatgcacta tacgcccagg cattaacaga tcaacaacag tttggtaaag ctgatgaaat gtatgataaa tgtattgatt tggaaccaga taatgctaca acatatgttc ataaaggttt acttcaactt cagtggaagc aagatctgga tagaggtttg gaacttatca gcaaggctat tgaaattgac aataaatgtg attttgccta tgaaaccatg ggaactattg aagtacaaag aggaaacatg gagaaagcca ttgacatgtt caacaaagct attaacctgg ccaaatcgga aatggagatg gcccatctgt attcactttg cgatgccgcc catgcccaga cagaagttgc aaagaaatac ggattaaaac caccaacatt ataa. It is sometimes possible for the material contained within the vial of "TOMM70A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
