TOE1 cdna clone
TOE1 cDNA Clone
Gene Names
TOE1; hCaf1z
Synonyms
TOE1; TOE1 cDNA Clone; TOE1 cdna clone
Sequence
atggccgccgacagtgacgatggcgcagtttcagctcccgcagcttccgacggtggtgtcagcaaaagcacaacatctggggaggagctagtagtccaggttcccgtagtggatgtgcaaagcaacaacttcaaggagatgtggccatccctcctgctagccataaagacagctaatttcgtggctgtggacacggagctgagtgggcttggggacaggaagagtttgctgaaccagtgcattgaggaacgttacaaggccgtgtgtcatgctgccaggacccgttctatcctttccctgggcctcgcctgcttcaagcggcagccagacaagggtgaacattcctatctggctcaagtgttcaatctcactctgctgtgcatggaggagtatgtcatagaaccaaagtctgtgcagttcctgatacagcatggcttcaacttcaaccagcagtatgcccaaggcatcccctaccataagggcaatgacaagggtgatgagagccagagccagtcagtacggaccctattcctggagctaatccgagcccgccggcccctggtgctacacaatggccttatagacttggtgttcctgtaccagaacttctatgcacacctccctgagagtctgggaaccttcaccgctgacctgtgtgagatgttcccagcaggcatttatgacaccaaatatgctgctgagtttcatgcccgtttcgtggcctcctacttagaatatgccttccggaaatgtgaacgggaaaatgggaagcagcgggcagctggcagcccacaccttaccctggagttctgcaactatccttccagcatgagggaccatattgattaccgctgctgcctgcccccagcaacccaccgtcctcatcccaccagcatctgtgacaacttctcggcttatggctggtgccccctgggaccacagtgtcctcagtctcacgatattgaccttatcattgacactgatgaggctgcggcagaggacaagcggcgacggcgacgacgtagggaaaaacggaagagggctttattgaacctaccggggacacagacctctggggaagctaaggatggtcctcccaagaagcaggtctgtggggatagcatcaagcctgaagaaaccgagcaggaggtggctgccgatgaaactaggaacctgcctcactccaagcaaggcaacaaaaatgacttagagatggggattaaggcagcaaggcctgaaatagctgatagagctacctcagaagtgccagggagccaagccagtcctaacccagtgcctggggatggattgcaccgggctggttttgatgcctttatgacaggttatgtgatggcctatgtggaagtgagccagggaccgcagccctgcagctctggaccctggctccctgaatgccacaataaggtatatttgagtggcaaagctgtacccctcacagtggccaagagccagttctctcgttcctccaaagcccacaatcagaagatgaagctcacttggggcagtagctga
Sequence Length
1533
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
47,890 Da
NCBI Official Full Name
Homo sapiens target of EGR1, member 1 (nuclear), mRNA
NCBI Official Synonym Full Names
target of EGR1, member 1 (nuclear)
NCBI Official Symbol
TOE1
NCBI Official Synonym Symbols
hCaf1z
NCBI Protein Information
target of EGR1 protein 1
UniProt Protein Name
Target of EGR1 protein 1
Protein Family
UniProt Gene Name
TOE1
UniProt Entry Name
TOE1_HUMAN
Uniprot Description
TOE1: Inhibits cell growth rate and cell cycle. Induces CDKN1A expression as well as TGF-beta expression. Mediates the inhibitory growth effect of EGR1. Belongs to the CAF1 family.
Protein type: Nucleolus
Chromosomal Location of Human Ortholog: 1p33
Cellular Component: Cajal body; cytoplasm; nucleoplasm; nucleus
Molecular Function: 3'-5'-exoribonuclease activity; poly(A)-specific ribonuclease activity; protein binding
Research Articles on TOE1
Similar Products
Product Notes
The TOE1 toe1 (Catalog #AAA1271395) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgccg acagtgacga tggcgcagtt tcagctcccg cagcttccga cggtggtgtc agcaaaagca caacatctgg ggaggagcta gtagtccagg ttcccgtagt ggatgtgcaa agcaacaact tcaaggagat gtggccatcc ctcctgctag ccataaagac agctaatttc gtggctgtgg acacggagct gagtgggctt ggggacagga agagtttgct gaaccagtgc attgaggaac gttacaaggc cgtgtgtcat gctgccagga cccgttctat cctttccctg ggcctcgcct gcttcaagcg gcagccagac aagggtgaac attcctatct ggctcaagtg ttcaatctca ctctgctgtg catggaggag tatgtcatag aaccaaagtc tgtgcagttc ctgatacagc atggcttcaa cttcaaccag cagtatgccc aaggcatccc ctaccataag ggcaatgaca agggtgatga gagccagagc cagtcagtac ggaccctatt cctggagcta atccgagccc gccggcccct ggtgctacac aatggcctta tagacttggt gttcctgtac cagaacttct atgcacacct ccctgagagt ctgggaacct tcaccgctga cctgtgtgag atgttcccag caggcattta tgacaccaaa tatgctgctg agtttcatgc ccgtttcgtg gcctcctact tagaatatgc cttccggaaa tgtgaacggg aaaatgggaa gcagcgggca gctggcagcc cacaccttac cctggagttc tgcaactatc cttccagcat gagggaccat attgattacc gctgctgcct gcccccagca acccaccgtc ctcatcccac cagcatctgt gacaacttct cggcttatgg ctggtgcccc ctgggaccac agtgtcctca gtctcacgat attgacctta tcattgacac tgatgaggct gcggcagagg acaagcggcg acggcgacga cgtagggaaa aacggaagag ggctttattg aacctaccgg ggacacagac ctctggggaa gctaaggatg gtcctcccaa gaagcaggtc tgtggggata gcatcaagcc tgaagaaacc gagcaggagg tggctgccga tgaaactagg aacctgcctc actccaagca aggcaacaaa aatgacttag agatggggat taaggcagca aggcctgaaa tagctgatag agctacctca gaagtgccag ggagccaagc cagtcctaac ccagtgcctg gggatggatt gcaccgggct ggttttgatg cctttatgac aggttatgtg atggcctatg tggaagtgag ccagggaccg cagccctgca gctctggacc ctggctccct gaatgccaca ataaggtata tttgagtggc aaagctgtac ccctcacagt ggccaagagc cagttctctc gttcctccaa agcccacaat cagaagatga agctcacttg gggcagtagc tga. It is sometimes possible for the material contained within the vial of "TOE1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
